Acosmetia caliginosa

(Hübner, 1813) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acosmetia

At a glance

Occurrence records770

Data sources7

Biological traits0

DNA specimens21

eDNA detections8

Sources7 archives

Databases and archives Acosmetia caliginosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility770 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF770 records

Environmental DNA1 datasets · 3 countries8 detections

DNA & barcodingBOLD21 specimens

01Narrative

Acosmetia caliginosa, the reddish buff, is a moth of the family Noctuidae. The species was first described by Jacob Hübner in 1813. It is found throughout continental Europe and in southern Scandinavia. then east across the Palearctic to Siberia. In Britain it is rare and has protected status, being possibly confined to a single site on the Isle of Wight.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acosmetia caliginosa has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes12

eDNA detections8

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

3Cmostly conserved

157Tvariable

238Tvariable

400Tvariable

477Gmostly conserved

628Avariable

646Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGTGCTGAATTAGGAACCCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes4

BIN1

Most divergent pair0.76%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acosmetia chinensissame genus4.6%Acosmetia biguttulasame genus4.8%Condica aroanasame family5.2%Hadjina wichtisame family5.5%Ethiopica vinosasame family5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5Patp6ATP8COIICOXIIICYTBND1ND3ND4ND4LND6MT-NADH5

animal barcodemitochondrialmarker

08Occurrence & distribution

Record type770 records

Wild obs. + sensor563

Museum / vouchered112

Other95

Origin

Native25

Range

Area of Occupancy AOO732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy12% within 1 km

≤100 m 31≤1 km 31≤10 km 438>10 km 2

502 georeferenced · 61 without coordinates

Open the mapobservation + sensor563

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 2≤1 km 34≤10 km 57>10 km 1

94 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence112

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	36
Zürich, CH	18
Sion, CH	7
UMUlocation not on record	6
SFRAlocation not on record	4
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	3
NCMGlocation not on record	3
Paro, BT	3
CBDClocation not on record	3
Muzeum Górnośląskie w Bytomiulocation not on record	2
Winterthur, CH	2
Uniwersytet Łódzkilocation not on record	2
Musee d'Histoire Naturallelocation not on record	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Museum zu Allerheiligen Schaffhausenlocation not on record	2
Philadelphia, US	2
Naturmuseum St. Gallenlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Bern, CH	1
Durban Natural Science Museumlocation not on record	1
Tiroler Landesmuseum Ferdinandeumlocation not on record	1
Research Collection of Richard Heindellocation not on record	1

22 institutions · 103 of 112 vouchered records shown · 9 without an institution code

09Environmental DNA8 detections

Where the DNA of Acosmetia caliginosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

flooded meadow, salix trees

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 13.9–20.1

Seasonal swing summer↔winter21.1 °C

Max temp (day)23.6 °C 18.1–24.7

Min temp (night)14.1 °C 8.60–15.2

Precipitation68.3 mm/mo 43.7–75.3

Air humidity57.3 % 56.5–58.0

Moisture balance-57.6 mm/mo -70.9–-47.8

Vapour deficit960 Pa 687–999

Wind speed3.20 m/s 2.80–3.80

Cloud cover35.7 % 34.1–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)