Acosmeryx socrates

Boisduval · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Acosmeryx

At a glance

Occurrence records41

Data sources7

Biological traits0

DNA specimens30

eDNA detections30

Sources7 archives

Databases and archives Acosmeryx socrates's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF41 records

Environmental DNA1 datasets · 1 countries30 detections

DNA & barcodingBOLD30 specimens

01Narrative

Acosmeryx socrates is a moth of the family Sphingidae. It is known from the Philippines.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acosmeryx socrates has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes1

eDNA detections30

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

1Tmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTATTAATTCGAGCAGAATTAGGTACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes6

BIN1

Most divergent pair0.61%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acosmeryx akanshisame genus4.7%Acosmeryx pseudonagasame genus5.0%Acosmeryx tenggarensissame genus5.2%Acosmeryx shervilliisame genus5.2%Acosmeryx castaneasame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type41 records

Wild obs. + sensor21

Museum / vouchered20

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 4≤1 km 5≤10 km 5

14 georeferenced · 7 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 12>10 km 1

13 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	13
Natural History Museum of Utahlocation not on record	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
South Kensington, GB	1

4 institutions · 17 of 20 vouchered records shown · 3 without an institution code

09Environmental DNA30 detections

Where the DNA of Acosmeryx socrates was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 19.5–28.2

Seasonal swing summer↔winter2.80 °C

Max temp (day)26.7 °C 22.2–28.8

Min temp (night)21.2 °C 15.5–27.2

Precipitation231 mm/mo 56.5–418

Air humidity70.1 % 63.2–73.5

Moisture balance157 mm/mo

Vapour deficit865 Pa 643–1,355

Wind speed2.50 m/s

Cloud cover50.1 % 34.8–60.5

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)