Acorigone acoreensis

(Wunderlich, 1992) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Acorigone

At a glance

Occurrence records1 110

Data sources8

Biological traits8

DNA specimens4

eDNA detections3

Sources8 archives

Databases and archives Acorigone acoreensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 110 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

World Spider Trait DBMasaryk University8 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF1 110 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD4 specimens

01Narrative

Acorigone acoreensis is een spinnensoort in de taxonomische indeling van de hangmatspinnen (Linyphiidae). Het dier behoort tot het geslacht Acorigone. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1992 door Jörg Wunderlich.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesMacías-Hernández et al. 2020

Morphometry6

Body length♀1.26·♂1.21 mm

Cephalothorax height♀0.118·♂0.118 mm

Cephalothorax length♀0.559·♂0.559 mm

Cephalothorax width♀0.412·♂0.412 mm

Fang length♀0.152·♂0.152 mm

Tibia I length♀0.324·♂0.324 mm

Ecology2

Circadian activity0.36 mm

Stratum0.9 mm

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acorigone acoreensis has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 93 variable positions, in barcode order

1Cvariable

4Amostly conserved

5Cmostly conserved

7Gmostly conserved

14Gmostly conserved

16Amostly conserved

22Amostly conserved

25Amostly conserved

28Gmostly conserved

34Cvariable

43Gmostly conserved

46Amostly conserved

49Gmostly conserved

74Cmostly conserved

76Amostly conserved

79Amostly conserved

83Amostly conserved

88Gmostly conserved

91Tvariable

97Gmostly conserved

106Cmostly conserved

110Cmostly conserved

112Amostly conserved

127Gmostly conserved

133Amostly conserved

143Amostly conserved

148Gmostly conserved

163Tmostly conserved

169Gmostly conserved

178Cmostly conserved

181Gmostly conserved

190Tmostly conserved

196Amostly conserved

202Tmostly conserved

205Amostly conserved

208Gmostly conserved

211Amostly conserved

214Amostly conserved

223Gvariable

235Cmostly conserved

238Gmostly conserved

241Cmostly conserved

244Gmostly conserved

262Amostly conserved

271Cmostly conserved

280Amostly conserved

283Amostly conserved

286Gmostly conserved

289Amostly conserved

310Gmostly conserved

316Gmostly conserved

319Amostly conserved

322Tmostly conserved

325Tmostly conserved

328Gmostly conserved

331Amostly conserved

334Tmostly conserved

343Tmostly conserved

346Tmostly conserved

349Amostly conserved

373Gmostly conserved

412Cmostly conserved

415Gmostly conserved

418Tmostly conserved

421Amostly conserved

430Gmostly conserved

433Gmostly conserved

436Tmostly conserved

439Cmostly conserved

445Cmostly conserved

451Tmostly conserved

454Cvariable

460Gmostly conserved

478Cmostly conserved

484Gmostly conserved

487Amostly conserved

496Cmostly conserved

502Amostly conserved

526Amostly conserved

532Amostly conserved

556Tmostly conserved

562Gmostly conserved

565Amostly conserved

604Cmostly conserved

619Cmostly conserved

622Gvariable

625Gmostly conserved

628Gmostly conserved

631Tmostly conserved

637Amostly conserved

640Amostly conserved

652Cmostly conserved

655Gmostly conserved

CAGACTGTATTTTGTATTTGGAGCATGGGCTGCCATAGTGGGGACAGCGATAAGAGTATTAATTCGGATTGAGCTAGGACAGATTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)7.3%

Haplotypes3

BINs2

Most divergent pair14.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gibothorax tchernovisame family12.4%Walckenaeria fraudatrixsame family13.4%Neocautinella neotericasame family13.5%Walckenaeria anticasame family13.5%Collinsia holmgrenisame family13.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 110 records

Wild obs. + sensor205

Museum / vouchered905

Origin

Native905

Range

Area of Occupancy AOO200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 204>10 km 1

205 georeferenced

Open the mapobservation + sensor205

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 905

905 georeferenced

Open the institutions mapphysical evidence905

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
UAclocation not on record	905

1 institutions · 905 of 905 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Acorigone acoreensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acorigone acoreensis

At a glance

Sources8 archives

Morphometry6

Ecology2

At a glance

Record type1 110 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Record type1 110 records