Acordulecera pellucida

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Pergidae/Acordulecera

At a glance

Occurrence records146

Data sources4

Biological traits0

DNA specimens8

eDNA detections21

Sources4 archives

Databases and archives Acordulecera pellucida's data was compiled from.

GBIFGlobal Biodiversity Information Facility146 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF146 records

Environmental DNA1 datasets · 2 countries21 detections

DNA & barcodingBOLD8 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acordulecera pellucida has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections21

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 43 variable positions, in barcode order

10Cmostly conserved

28Gmostly conserved

44Tmostly conserved

49Tmostly conserved

61Cmostly conserved

82Cmostly conserved

85Tmostly conserved

94Cmostly conserved

109Amostly conserved

127Cmostly conserved

142Cmostly conserved

178Amostly conserved

202Cmostly conserved

250Cmostly conserved

266Tmostly conserved

310Tmostly conserved

317Tmostly conserved

319Amostly conserved

325Cmostly conserved

340Tmostly conserved

358Cmostly conserved

364Tmostly conserved

370Tmostly conserved

374Amostly conserved

387Cmostly conserved

433Amostly conserved

436Amostly conserved

466Gmostly conserved

482Amostly conserved

499Tmostly conserved

514Amostly conserved

523Tmostly conserved

529Amostly conserved

550Cmostly conserved

562Tmostly conserved

595Cmostly conserved

607Amostly conserved

616Tmostly conserved

619Cmostly conserved

625Tmostly conserved

640Cmostly conserved

643Tmostly conserved

646Cmostly conserved

AACTTTATACTTTATTTTTGGAATATGGGCAGGAATAATTGGATTATCTCTTAGAATAATCATTCGAACAGAACTTAGATCCCCTTCATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes3

BINs2

Most divergent pair6.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acordulecera dorsalissame genus13.5%Tequus schrottkyisame family15.2%Heptamelus viitasaariisame order17.0%Platycampus luridiventrissame order17.5%Phylacteophaga froggattisame family17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type146 records

Museum / vouchered146

Range

Area of Occupancy AOO276 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 2≤1 km 22≤10 km 94

118 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence146

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	119
OSUClocation not on record	27

2 institutions · 146 of 146 vouchered records shown

09Environmental DNA21 detections

Where the DNA of Acordulecera pellucida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map2 countries0

5. Wetlands (inland)|5.4. Bogs, Marshes, Swa…Agricultural14. Artificial - Terrestrial|14.1 Arable Land1. Forest & WoodlandForest14. Artificial - Terrestrial|14.5 Urban Areas

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 12.9–21.2

Seasonal swing summer↔winter26.4 °C

Max temp (day)23.0 °C 18.6–26.8

Min temp (night)14.6 °C 8.00–17.8

Precipitation89.0 mm/mo 80.4–132

Air humidity59.4 % 56.6–60.1

Moisture balance-31.0 mm/mo -64.1–-4.00

Vapour deficit849 Pa 667–1,022

Wind speed3.30 m/s 2.50–4.20

Cloud cover43.8 % 39.5–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)