Acoptus suturalis

J.Lec., 1876 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Acoptus

At a glance

Occurrence records239

Data sources5

Biological traits0

DNA specimens49

eDNA detections47

Sources5 archives

Databases and archives Acoptus suturalis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility239 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI47 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF239 records

Environmental DNA1 datasets · 2 countries47 detections

DNA & barcodingBOLD49 specimens

01Narrative

Acoptus is a genus of true weevils in the family of beetles known as Curculionidae. There is one described species in Acoptus, A. suturalis, found in the northeastern United States and southeastern Canada. It can commonly be found near beaver dams.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acoptus suturalis has left across the world's sequence archives.

At a glance

DNA specimens49

BINs2

Marker genes1

eDNA detections47

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

1Avariable

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

5Cmostly conserved

7Amostly conserved

9Amostly conserved

10Cmostly conserved

22Avariable

28Gmostly conserved

40Amostly conserved

49Amostly conserved

85Amostly conserved

118Cmostly conserved

130Tmostly conserved

133Tmostly conserved

148Amostly conserved

154Cvariable

181Gmostly conserved

217Gvariable

223Cmostly conserved

268Amostly conserved

283Tmostly conserved

298Tmostly conserved

319Amostly conserved

322Amostly conserved

385Tmostly conserved

415Gvariable

421Cmostly conserved

535Cmostly conserved

550Tmostly conserved

553Amostly conserved

583Amostly conserved

631Amostly conserved

634Cvariable

640Cvariable

646Tvariable

AACTCTATACTTTATTTTTGGAAGATGGGCAGGAATAGTAGGTACTTCACTCAGAATATTAATTCGTACAGAATTAGGAAATCCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes6

BINs2

Most divergent pair3.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Leiosoma deflexumsame family16.0%Larinus obtusussame family16.6%Morimotodes ismenesame family17.1%Sitona hispidulussame family17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type239 records

Wild obs. + sensor67

Museum / vouchered172

Range

Area of Occupancy AOO512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 27≤1 km 16≤10 km 6>10 km 6

55 georeferenced · 12 without coordinates

Open the mapobservation + sensor67

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 4≤10 km 13>10 km 1

18 georeferenced · 154 without coordinates

Open the institutions mapphysical evidence172

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	72
Albany, US	18
University of Guelph, Centre for Biodiversity Genomicslocation not on record	16
University of Guelphlocation not on record	14
ASUlocation not on record	8
Philadelphia, US	7
Cambridge, US	3
University of Alabamalocation not on record	3
Biodiversity Institute of Ontariolocation not on record	2
UDlocation not on record	2
Saint John, CA	2
Chicago, US	1
Espace pour la vielocation not on record	1
MAJClocation not on record	1
Lubbock, US	1

15 institutions · 151 of 172 vouchered records shown · 21 without an institution code

09Environmental DNA47 detections

Where the DNA of Acoptus suturalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found47

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 47 detections have coordinates

Open the map2 countries0

Mixed habitatTemperate mixed forest1. Forest & WoodlandForest1. Forest & Woodland|1.4. Temperate Forest14. Artificial - Terrestrial|14.5 Urban Areas

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 11.3–18.3

Seasonal swing summer↔winter26.1 °C

Max temp (day)18.3 °C 15.0–23.5

Min temp (night)12.2 °C 8.10–14.9

Precipitation94.1 mm/mo 83.9–126

Air humidity58.7 % 56.2–63.0

Moisture balance-17.9 mm/mo

Vapour deficit678 Pa 553–866

Wind speed3.60 m/s

Cloud cover46.5 % 39.8–53.4

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)