Aconurella prolixa

(Lethierry, 1885) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Aconurella

At a glance

Occurrence records301

Data sources5

Biological traits0

DNA specimens128

eDNA detections170

Sources5 archives

Databases and archives Aconurella prolixa's data was compiled from.

GBIFGlobal Biodiversity Information Facility301 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI170 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics128 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF301 records

Environmental DNA1 datasets · 8 countries170 detections

DNA & barcodingBOLD128 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding128 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aconurella prolixa has left across the world's sequence archives.

At a glance

DNA specimens128

BINs3

Marker genes2

eDNA detections170

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus110 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

ATTATATTTTATCTTTGGTATTTGGTCAGGAATAGTAGGAATGATATTAAGAATAATTATTCGTATTGAGCTTTCTCAACCAGGGTCGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes23

BINs2

Most divergent pair6.0%

AsiaEuropeOtherAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aconurella sibiricasame genus11.5%Aconurella diplachnissame genus13.4%Zahniserius cylindricussame family15.3%Maiestas heuksandoensissame family15.3%Gloridonus vetulussame family15.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type301 records

Wild obs. + sensor91

Museum / vouchered210

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 20≤1 km 2≤10 km 8

30 georeferenced · 61 without coordinates

Open the mapobservation + sensor91

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 78≤1 km 116

194 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence210

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	187
Bonn, DE	10
Cape Town, ZA	3
Helsinki, FI	2
Sofia University, St. Kliment Ohridskilocation not on record	1

5 institutions · 203 of 210 vouchered records shown · 7 without an institution code

09Environmental DNA170 detections

Where the DNA of Aconurella prolixa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found170

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 170 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.9 °C 16.6–33.4

Seasonal swing summer↔winter20.8 °C

Max temp (day)34.9 °C 21.9–39.1

Min temp (night)22.0 °C 9.80–27.2

Precipitation26.5 mm/mo 0.8–163

Air humidity50.2 % 43.2–59.7

Moisture balance-136 mm/mo -210–7.80

Vapour deficit1,885 Pa 922–2,691

Wind speed2.60 m/s 1.90–4.30

Cloud cover18.1 % 4.40–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 151 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)