Acontia wahlbergi

Wallengren, 1856 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acontia

At a glance

Occurrence records30

Data sources5

Biological traits0

DNA specimens5

eDNA detections0

Sources5 archives

Databases and archives Acontia wahlbergi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF30 records

DNA & barcodingBOLD5 specimens

01Narrative

Acontia wahlbergi is een vlinder van de familie van de uilen (Noctuidae). De wetenschappelijke naam van deze soort is voor het eerst voorgesteld door Hans Daniel Johan Wallengren in een publicatie uit 1856. De soort komt voor in het Afrotropisch gebied waaronder Mauritanië, Senegal, Gambia, Ivoorkust, Burkina Faso, Ghana, Nigeria, Kameroen, Congo-Kinshasa, Eritrea, Ethiopië, Oeganda, Kenia, Tanzania, Angola, Zambia, Mozambique, Namibië, Botswana, Zimbabwe en Zuid-Afrika.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acontia wahlbergi has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.91%

Haplotypes2

BIN1

Most divergent pair1.4%

Where individuals differ — all 9 variable positions, in barcode order

97Tvariable

193Cvariable

268Cvariable

394Tvariable

400Tvariable

427Cvariable

433Avariable

500Cvariable

622Avariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hypocala guttiventrissame order6.7%Adrapsa geometroidessame order7.0%Omphalophana anatolicasame family7.0%Eusceptis lelaesame family7.1%Chlumetia transversasame order7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type30 records

Wild obs. + sensor23

Museum / vouchered7

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 10≤1 km 4

14 georeferenced · 9 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ZSMlocation not on record	4
Bavarian State Collection of Zoologylocation not on record	2

2 institutions · 6 of 7 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)