Acontia lucida

Hufnagel, 1766 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acontia

At a glance

Occurrence records13 227

Data sources9

Biological traits2

DNA specimens72

eDNA detections61

Sources9 archives

Databases and archives Acontia lucida's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 227 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI61 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics72 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF13 227 records

Environmental DNA1 datasets · 16 countries61 detections

DNA & barcodingBOLD72 specimens

Genome at a glanceGoaT · NCBI≈422 Mbp

01Narrative

Acontia lucida, the pale shoulder, is a moth of the family Noctuidae. The species was first described by Johann Siegfried Hufnagel in 1766."Pale Shoulder Acontia lucida (Hufnagel, 1766)". BioLib. Retrieved 20 September 2020.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding72 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acontia lucida has left across the world's sequence archives.

At a glance

DNA specimens72

BINs1

Marker genes14

eDNA detections61

Countries19

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus55 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

56Cmostly conserved

115Cvariable

229Gvariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGACTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.27%

Haplotypes8

BIN1

Most divergent pair0.76%

EuropeOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acontia biskrensissame genus5.3%Ponometia macdunnoughisame family6.5%Acontia trabealissame genus6.8%Eutelia auratrixsame order7.0%Polymixis germanasame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5Patp6ATP8COIICOXIIICYTBND1ND2ND3ND4ND4LND6MT-NADH5

animal barcodemitochondrialmarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acontia lucida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈422 400 187 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acontia lucida0.42 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.5% BUSCO

08Occurrence & distribution

Record type13 227 records

Wild obs. + sensor11 348

Museum / vouchered481

Other1 398

Origin

Native139

Range

Area of Occupancy AOO24 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 4 719≤1 km 1 389≤10 km 1 428>10 km 243

7 779 georeferenced · 3 569 without coordinates

Open the mapobservation + sensor11 348

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 36≤1 km 135≤10 km 139>10 km 14

324 georeferenced · 157 without coordinates

Open the institutions mapphysical evidence481

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UMUlocation not on record	69
Provincia di Livornolocation not on record	62
Tartu, EE	55
Zürich, CH	39
Natural History Museum Rotterdamlocation not on record	26
SFRAlocation not on record	18
Nijmegen, NL	15
Sion, CH	13
Philadelphia, US	10
Adam Mickiewicz University in Poznańlocation not on record	8
Museu Nacional de História Natural e da Ciêncialocation not on record	8
ZSMlocation not on record	6
Salzburg, AT	5
DABUHlocation not on record	5
Musee d'Histoire Naturallelocation not on record	4
Uniwersytet Łódzkilocation not on record	3
Tallinn, EE	2
Muzeum Górnośląskie w Bytomiulocation not on record	2
ЗММУlocation not on record	2
Naturmuseum Oltenlocation not on record	2
NHMOlocation not on record	2
ЗМКУlocation not on record	2
Banyoles, ES	1
MZLUlocation not on record	1
John May Museum of Natural Historylocation not on record	1
Radicondoli, IT	1
National Museum of Natural History, Bulgarian Academy of Scienceslocation not on record	1
DanishLepidopterologicalSocietylocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

31 institutions · 367 of 481 vouchered records shown · 114 without an institution code

09Environmental DNA61 detections

Where the DNA of Acontia lucida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found61

Studies independent surveys1

Countries16

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 61 detections have coordinates

Open the map16 countries0

Dry calcareous grasslandsChenaies a Chene vert des collines corses (G…private gardenMeadow83Urban area

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 11.6–25.8

Seasonal swing summer↔winter16.9 °C

Max temp (day)23.6 °C 15.4–31.4

Min temp (night)14.0 °C 6.90–21.3

Precipitation40.1 mm/mo 4.60–80.4

Air humidity56.3 % 49.2–61.3

Moisture balance-73.6 mm/mo

Vapour deficit993 Pa 597–1,663

Wind speed3.00 m/s

Cloud cover35.7 % 21.1–43.1

CHELSA 1981–2010, ~9 km grid, at location & month of 53 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acontia lucida

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type13 227 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type13 227 records