Acontia discoidea

Hopffer, 1862 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acontia

At a glance

Occurrence records152

Data sources6

Biological traits0

DNA specimens10

eDNA detections2

Sources6 archives

Databases and archives Acontia discoidea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility152 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF152 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD10 specimens

01Narrative

Acontia discoidea is een vlinder van de familie van de uilen (Noctuidae). De wetenschappelijke naam van deze soort is voor het eerst voorgesteld door Carl Heinrich Hopffer in een publicatie uit 1857. De soort komt voor in tropisch Afrika waaronder Djibouti, Ethiopië, Somalië, Congo-Kinshasa, Kenia, Tanzania, Angola, Zambia, Mozambique, Namibië, Botswana, Zimbabwe en Zuid-Afrika.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acontia discoidea has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections2

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

40Tmostly conserved

55Tmostly conserved

56Cmostly conserved

59Cmostly conserved

76Amostly conserved

82Tmostly conserved

106Tmostly conserved

127Tvariable

157Cvariable

163Tmostly conserved

187Tvariable

190Amostly conserved

238Amostly conserved

268Tvariable

284Cmostly conserved

286Tvariable

292Cvariable

337Cvariable

343Cvariable

346Tmostly conserved

379Tmostly conserved

418Tmostly conserved

436Tmostly conserved

457Tmostly conserved

487Tmostly conserved

493Avariable

532Cvariable

542Cmostly conserved

544Tmostly conserved

556Tmostly conserved

562Tvariable

595Tmostly conserved

613Cvariable

616Cmostly conserved

619Amostly conserved

652Tmostly conserved

658Cvariable

AACTTTATATTTTATTTTTGGTATTTGAGCTGGAATAGTTGGAACATCTTTAAGTCTACTAATTCGAGCTGAATTAGGTAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes8

BINs2

Most divergent pair4.9%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acontia gradatasame genus3.3%Acontia sectasame genus4.3%Acontia carnescenssame genus4.6%Acontia albatrigonasame genus6.4%Eremohadena immundasame family7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type152 records

Wild obs. + sensor146

Museum / vouchered6

Range

Area of Occupancy AOO336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 80≤1 km 11≤10 km 6

97 georeferenced · 49 without coordinates

Open the mapobservation + sensor146

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Museums of Kenyalocation not on record	3
Tartu, EE	2
ZSMlocation not on record	1

3 institutions · 6 of 6 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Acontia discoidea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 20.5–21.6

Seasonal swing summer↔winter2.50 °C

Max temp (day)26.4 °C 26.0–26.8

Min temp (night)15.5 °C 14.9–16.1

Precipitation122 mm/mo 87.4–157

Air humidity56.6 % 54.9–58.2

Moisture balance-29.2 mm/mo -71.0–12.6

Vapour deficit1,087 Pa 1,009–1,166

Wind speed3.30 m/s 2.80–3.80

Cloud cover38.6 % 29.6–47.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)