Acontia crocata

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acontia

At a glance

Occurrence records69

Data sources7

Biological traits0

DNA specimens26

eDNA detections24

Sources7 archives

Databases and archives Acontia crocata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility69 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF69 records

Environmental DNA1 datasets · 1 countries24 detections

DNA & barcodingBOLD26 specimens

01Narrative

Acontia crocata is a moth of the family Noctuidae. It is found from India to Australia. In 2003, it was recorded from Deux-Sèvres in France. The wingspan is about 20 mm. Adults have dark-brown forewings. The male has white patches on the costa, while the female has an orange basal area. The hindwings are brown with orange basal areas. The larvae feed on Ligustrum vulgare.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acontia crocata has left across the world's sequence archives.

At a glance

DNA specimens26

BINs2

Marker genes1

eDNA detections24

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

40Amostly conserved

55Amostly conserved

82Tmostly conserved

124Cvariable

145Cmostly conserved

181Amostly conserved

205Tmostly conserved

220Cmostly conserved

301Amostly conserved

346Cmostly conserved

379Amostly conserved

382Cmostly conserved

386Tmostly conserved

391Tmostly conserved

397Tmostly conserved

499Amostly conserved

532Tmostly conserved

548Tvariable

628Tmostly conserved

634Tmostly conserved

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGACTATTAATTCGAGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes9

BINs2

Most divergent pair3.0%

OceaniaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acontia gratiosasame genus3.5%Acontia trabealissame genus5.2%Acontia anticasame genus5.6%Acontia bicolorasame genus5.8%Acontia torrefactasame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type69 records

Wild obs. + sensor34

Museum / vouchered35

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 13≤1 km 14

27 georeferenced · 7 without coordinates

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 9

9 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	19
Helsinki, FI	11
Centre for Biodiversity Genomicslocation not on record	1

3 institutions · 31 of 35 vouchered records shown · 4 without an institution code

09Environmental DNA24 detections

Where the DNA of Acontia crocata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median29.7 °C 23.1–29.9

Seasonal swing summer↔winter7.60 °C

Max temp (day)34.0 °C 27.9–35.2

Min temp (night)25.0 °C 18.4–26.5

Precipitation146 mm/mo 26.9–324

Air humidity59.5 % 49.6–65.1

Moisture balance-35.0 mm/mo -91.4–129

Vapour deficit1,702 Pa 1,144–1,779

Wind speed2.60 m/s 1.60–3.60

Cloud cover44.1 % 25.8–52.1

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)