Acontia cretata

Grote & Robinson, 1870 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acontia

At a glance

Occurrence records1 265

Data sources7

Biological traits0

DNA specimens18

eDNA detections21

Sources7 archives

Databases and archives Acontia cretata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 265 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 265 records

Environmental DNA1 datasets · 2 countries21 detections

DNA & barcodingBOLD18 specimens

01Narrative

Acontia cretata, the chalky bird dropping moth, is a moth of the family Noctuidae. The species was first described by Augustus Radcliffe Grote and Coleman Townsend Robinson in 1870. It is found from the US states of California to Texas and Oklahoma, north to Colorado and Utah. The wingspan is 22–27 mm. Adults are on wing from April to September. The larva has been recorded as a host of the parasitoid braconid wasp Bracon mellitor.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acontia cretata has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections21

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 72 variable positions, in barcode order

13Tmostly conserved

19Cmostly conserved

40Tmostly conserved

43Tmostly conserved

44Amostly conserved

55Tmostly conserved

88Tmostly conserved

91Amostly conserved

100Amostly conserved

103Tmostly conserved

118Tmostly conserved

127Amostly conserved

130Tmostly conserved

154Cmostly conserved

157Tmostly conserved

184Amostly conserved

200Gmostly conserved

202Amostly conserved

205Tmostly conserved

206Tmostly conserved

208Amostly conserved

220Cmostly conserved

223Amostly conserved

232Tmostly conserved

235Cmostly conserved

256Amostly conserved

271Tmostly conserved

277Tmostly conserved

283Amostly conserved

284Tmostly conserved

286Amostly conserved

298Amostly conserved

325Amostly conserved

334Amostly conserved

340Tmostly conserved

352Amostly conserved

358Tmostly conserved

364Amostly conserved

370Tmostly conserved

373Tmostly conserved

376Amostly conserved

386Cmostly conserved

389Gmostly conserved

391Amostly conserved

400Amostly conserved

401Tmostly conserved

403Amostly conserved

406Tmostly conserved

421Amostly conserved

436Tmostly conserved

454Amostly conserved

484Amostly conserved

499Tmostly conserved

506Amostly conserved

517Amostly conserved

520Tmostly conserved

526Amostly conserved

529Tmostly conserved

541Cmostly conserved

553Tmostly conserved

556Tmostly conserved

578Cmostly conserved

580Tmostly conserved

586Gvariable

601Tmostly conserved

619Tmostly conserved

622Tmostly conserved

631Amostly conserved

641Cmostly conserved

643Amostly conserved

653Cmostly conserved

655Tmostly conserved

AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTTGGTACATCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes8

BIN1

Most divergent pair10.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acontia jaliscanasame genus5.9%Pararcte schneiderianasame order7.0%Ponometia macdunnoughisame family7.0%Caligatus angasiisame order7.6%Zanclognatha zelleralissame order7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 265 records

Wild obs. + sensor972

Museum / vouchered293

Range

Area of Occupancy AOO2 124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 602≤1 km 103≤10 km 30>10 km 92

827 georeferenced · 145 without coordinates

Open the mapobservation + sensor972

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 12≤1 km 18≤10 km 163>10 km 24

217 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence293

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	89
San Diego, US	46
Mississippi State, US	32
East Lansing, US	31
US	24
Albuquerque, US	17
New Haven, US	12
St. Paul, US	12
Awka, NG	9
San Francisco, US	4
Denver, US	4
University of Alberta Museums (UAM)location not on record	2
Colorado State Universitylocation not on record	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Georgia Museum of Natural Historylocation not on record	1
Cornell University Insect Collectionlocation not on record	1
University of California, Davislocation not on record	1
Chicago, US	1

18 institutions · 289 of 293 vouchered records shown · 4 without an institution code

09Environmental DNA21 detections

Where the DNA of Acontia cretata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 15.0–27.5

Seasonal swing summer↔winter19.3 °C

Max temp (day)29.9 °C 20.8–33.2

Min temp (night)18.2 °C 9.70–22.0

Precipitation53.5 mm/mo 8.80–80.6

Air humidity51.9 % 37.2–60.3

Moisture balance-114 mm/mo -171–-43.7

Vapour deficit1,479 Pa 756–1,899

Wind speed3.30 m/s 1.90–4.30

Cloud cover24.1 % 13.6–32.8

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acontia cretata

At a glance

Sources7 archives

At a glance

Record type1 265 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 265 records