Aconitum coreanum

(H.Lév.) Rapaics · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Aconitum

At a glance

Occurrence records180

Data sources12

Biological traits25

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Aconitum coreanum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility180 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Chemical compositionLOTUS · NPASS33 compounds

Occurrence & distributionGBIF180 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Aconitum coreanum, known as Korean monkshood, is one of the species of Aconitum. It is one of the crude botanical drugs that has been applied in Chinese medicine during past decades.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Leaf length53 mm

Leaf length max64 mm

Leaf length min42 mm

Leaf width50 mm

Leaf width max64 mm

Leaf width min36 mm

Plant height0.65 m

Plant height max1.5 m

Plant height min0.3 m

Life cycle & reproduction5

Flowering endSep

Flowering startAug

Life formperennial or tuberous geophyte

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max900 m

Elevation mean550 m

Elevation min200 m

Growth formherb

Habitat GIFTmeadows, mountains, stony places

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition33 compounds

Compounds documented for Aconitum coreanum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Terpenoid alkaloids15

Kaurane and Phyllocladane diterpenoids1

Germacrane sesquiterpenoids1

Simple indole alkaloids1

Hydrocarbons1

Documented compounds33 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,4S,7R,10R,11R)-5-[[(3aR,6S,7aS)-6-hydroxy-1-methyl-3,6,7,7a-tetrahydro-2H-indol-3a-yl]methyl]-13-acetyl-11-methyl-13-azapentacyclo[9.3.3.24,7.01,10.02,7]nonadec-5-en-14-one	present	LOTUS
(1S,2E,10R)-3,7,11,11-tetramethylbicyclo[8.1.0]undeca-2,6-diene	present	NPASS
(1S,2R,4R,6R,7R,10S,11S,12S)-11-methyl-5-methylidene-14-oxa-16-azahexacyclo[9.6.3.24,7.01,10.02,7.012,16]docosan-6-ol	present	LOTUS
(2alpha,11alpha,13S)-Hetisan-2,11,13,14-tetrol 2-(2-methylpropanoate)	present	LOTUS
(2R)-5-acetyl-6-hydroxy-2-propan-2-yl-1-benzofuran-3-one	present	NPASS
(3aR,7aS)-1-methyl-3a-[[(1R,5R,11R,12S,14R,17S,20R,21R)-5-methyl-10-oxa-7-azaheptacyclo[12.6.2.01,11.05,20.07,11.012,17.017,21]docos-15-en-15-yl]methyl]-2,3,7,7a-tetrahydroindol-6-one	present	LOTUS
1-[(2R,3R)-3,6-dihydroxy-2-prop-1-en-2-yl-2,3-dihydro-1-benzofuran-5-yl]ethanone	present	NPASS
1-[(2R,3R)-3,6-dihydroxy-2-propan-2-yl-2,3-dihydro-1-benzofuran-5-yl]ethanone	present	NPASS
2-Decene-4,6-diynoic acid, methyl ester, (Z)-	present	NPASS
3-(1H-Indol-3-Yl)-2-(Trimethylazaniumyl)Propanoate	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aconitum coreanum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH047596.1 ↗210 bp

ACGT

CACAGCGTCGCACCCCGTCAACCACGTTGTCGAGGAACGGAGATTGGCCCCCCGGGCCCCTGCGGGCACGGTCGGCACAAATATGTTTTT …

Aconitum coreanum isolate HHWT1.10 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aconitum coreanum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records32–322n range32median32mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 323×CCDB · DCDB-2016

CCDB · DCDB-2016 — Chung, K.-S., B.-M. Nam, M.-S. Park, J.-A. Eom, B.-U. Oh & G.-Y. Chung. 2011. Chromosome numbers of eight taxa of Aconitum L. in Korea and their systematic significance (Ranunculaceae). Korean J. Pl. Taxonomy 41(3): 215-222.

CCDB · DCDB-2016 — Lee, Y. N. 1967. Chromosome numbers of flowering plants in Korea (1). J. Korea Cult. Res. Inst. 11: 455-478.

CCDB · DCDB-2016 — Volkova, S. A. & L. M. Pshennikova. 2013. Chromosome numbers of some plant species of the Primorye territory. Turczaninowia 16(2): 121–126.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type180 records

Wild obs. + sensor33

Museum / vouchered146

Other1

Range

Area of Occupancy AOO384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 8

9 georeferenced · 24 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 1≤10 km 21

22 georeferenced · 124 without coordinates

Open the institutions mapphysical evidence146

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institute of Applied Ecology, Academia Sinicalocation not on record	61
KR	15
Beijing, CN	14
Herbarium of the Department of Botany, University of Tokyolocation not on record	12
Northeastern Forestry Universitylocation not on record	8
Kyoto Universitylocation not on record	6
Nanjing, CN	4
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	3
Tsukuba, JP	3
东北师范大学自然博物馆location not on record	2
Elocation not on record	2
Plocation not on record	2
Siouxland Heritage Museumlocation not on record	2
Beijing, CN	2
SMMUlocation not on record	1
Taipei, TW	1
Chengdu, CN	1
Moscow State Universitylocation not on record	1
Kew, GB	1
Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record	1
Shenyang Agricultural Universitylocation not on record	1
Beijing Natural History Museumlocation not on record	1
Saint Louis, US	1
SXTCMlocation not on record	1

24 institutions · 146 of 146 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Aconitum coreanum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)