Acomys cahirinus

(É.Geoffroy, 1803) · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Rodentia/Muridae/Acomys

At a glance

Occurrence records1 086

Data sources8

Biological traits0

DNA specimens108

eDNA detections18

Sources8 archives

Databases and archives Acomys cahirinus's data was compiled from.

WikipediaWikimedia Foundation16 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 086 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics108 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 086 records

Environmental DNA1 datasets · 0 countries18 detections

DNA & barcodingBOLD108 specimens

Genome at a glanceGoaT2.6 Gbp

01Narrative

The Cairo spiny mouse (Acomys cahirinus), also known as the common spiny mouse, Egyptian spiny mouse, or Arabian spiny mouse, is a nocturnal species of rodent in the family Muridae. It is found in Africa north of the Sahara, where its natural habitats are rocky areas and hot deserts. It is omnivorous and feeds on seeds, desert plants, snails, and insects. It is a gregarious animal and lives in small family groups. It is the first and only known rodent species that exhibit spontaneous decidualization and menstruation.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding108 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acomys cahirinus has left across the world's sequence archives.

At a glance

DNA specimens108

BINs1

Marker genes13

eDNA detections18

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P957 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.04%

Haplotypes2

BIN1

Most divergent pair0.21%

Where individuals differ — all 2 variable positions, in barcode order

717Gmostly conserved

937Tmostly conserved

CACAAAGACATCGGAACCCTATACCTTATCTTCGGAGCCTGAGCTGGCATAGTGGGAACAGCCCTTAGTATTCTCATCCGAGCCGAACTG …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5Patp6COIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6D-loop

animal barcodemitochondrialmarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_020758 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Acomys cahirinus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 581 920 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acomys cahirinus2.58 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Chromosome records36–382n range38median38mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 382×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

2n 361×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness71.3% BUSCO

08Occurrence & distribution

Record type1 086 records

Wild obs. + sensor35

Museum / vouchered1 051

Origin

Native17

Range

Area of Occupancy AOO904 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 27≤1 km 1>10 km 1

29 georeferenced · 6 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 84≤1 km 4≤10 km 20>10 km 105

213 georeferenced · 838 without coordinates

Open the institutions mapphysical evidence1 051

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	673
Washington, US	148
Ann Arbor, US	45
Berkeley, US	43
National Natural History Collectionslocation not on record	32
Royal Museum for Central Africalocation not on record	24
South Kensington, GB	20
Toronto, CA	13
Geneva, CH	9
Los Angeles, US	9
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	8
Paris, FR	7
Ithaca, US	6
Denver, US	3
Lubbock, US	3
East Lansing, US	2
Zacatecas, MX	1
CASlocation not on record	1
Wuzhou, CN	1
Texas Cooperative Wildlife Collectionlocation not on record	1

20 institutions · 1 049 of 1 051 vouchered records shown · 2 without an institution code

09Environmental DNA18 detections

Where the DNA of Acomys cahirinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acomys cahirinus

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type1 086 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 086 records