Acompus rufipes

(Wolff, 1802) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Rhyparochromidae/Acompus

At a glance

Occurrence records1 457

Data sources9

Biological traits2

DNA specimens10

eDNA detections7

Sources9 archives

Databases and archives Acompus rufipes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 457 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 457 records

Environmental DNA1 datasets · 4 countries7 detections

DNA & barcodingBOLD10 specimens

Genome at a glanceGoaT2n = 14

01Narrative

Acompus rufipes is a species of true bug belonging to the family Rhyparochromidae. It is native to Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acompus rufipes has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections7

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.22%

Haplotypes1

BIN1

Where individuals differ — all 5 variable positions, in barcode order

124Tmostly conserved

312Tmostly conserved

340Cmostly conserved

406Cmostly conserved

634Cmostly conserved

GACATTATATTTCATTTTCGGTATATGATCAGGAATATTAGGTTCATCTCTAAGATGAATTATCCGTGTAGAATTAGGACAACCAGGCAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neoneides muticussame order13.5%Xanthochilus quadratussame family13.5%Nysius simulanssame order13.5%Peritrechus lundisame family13.7%Nysius angustatussame order13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Acompus rufipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type1 457 records

Wild obs. + sensor1 121

Museum / vouchered262

Other74

Range

Area of Occupancy AOO3 656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 318≤1 km 247≤10 km 434>10 km 6

1 005 georeferenced · 116 without coordinates

Open the mapobservation + sensor1 121

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 99≤1 km 81≤10 km 29

209 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence262

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	33
NHMOlocation not on record	32
SLU Artdatabankenlocation not on record	32
Bonn, DE	13
Tartu, EE	11
Philadelphia, US	10
neflocation not on record	10
ZSMlocation not on record	9
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	8
CBDClocation not on record	5
NCMGlocation not on record	4
Natural History Museum, Londonlocation not on record	3
Forssa, FI	3
BioFokuslocation not on record	2
Metsähallituslocation not on record	2
NTNU-VMlocation not on record	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
Ugentlocation not on record	2
National Institute of Biological Resourceslocation not on record	1
Helsinki, FI	1
Jyväskylä, FI	1
ZMAAlocation not on record	1

22 institutions · 187 of 262 vouchered records shown · 75 without an institution code

09Environmental DNA7 detections

Where the DNA of Acompus rufipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 3.70–15.8

Seasonal swing summer↔winter19.6 °C

Max temp (day)12.8 °C 7.00–19.9

Min temp (night)6.20 °C -0.6–11.8

Precipitation56.8 mm/mo 34.6–233

Air humidity60.6 % 59.7–62.3

Moisture balance-21.1 mm/mo -40.6–124

Vapour deficit512 Pa 316–710

Wind speed3.30 m/s 2.10–4.20

Cloud cover38.4 % 37.1–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acompus rufipes

At a glance

Sources9 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 457 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 457 records