Acompsia schmidtiellus

(Heyden, 1848) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Acompsia

At a glance

Occurrence records232

Data sources8

Biological traits2

DNA specimens15

eDNA detections13

Sources8 archives

Databases and archives Acompsia schmidtiellus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility232 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF232 records

Environmental DNA1 datasets · 4 countries13 detections

DNA & barcodingBOLD15 specimens

01Narrative

Acompsia schmidtiellus is a moth of the family Gelechiidae. It is found in central, eastern and southern Europe, from Denmark to southern Spain and Portugal. In the east, the range extends to Ukraine.Fauna Europaea The wingspan is 14–16 mm for males and 15–17 mm for females. The forewings are light orange-brown, mottled with some black scales. Females have more plain orange-brown forewings. The hindwings are grey. Adults are on wing from June to late August. The larvae feed on Origanum vulgare, Mentha arvensis, Mentha silvestris, Mentha rotundifolia, Calamintha nepeta and Clinopodium vulgare. They fold a leaf of their host plant and spin it together. The larvae are yellow white with a shining dark brown head. Pupation takes place in a folded leaf or between dry leaves on the ground.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acompsia schmidtiellus has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections13

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.05%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

370Gmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTTTAAGTCTTTTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Filatima albilorellasame family8.5%Acompsia tripunctellasame genus8.5%Prasinocyma floresariasame order8.5%Filatima epulatrixsame family8.7%Filatima serotinellasame family8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type232 records

Wild obs. + sensor203

Museum / vouchered29

Range

Area of Occupancy AOO496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 86≤1 km 42≤10 km 51>10 km 3

182 georeferenced · 21 without coordinates

Open the mapobservation + sensor203

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 8≤1 km 6≤10 km 1

15 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	11
South Kensington, GB	3
European Distributed Institute of Taxonomy (EDIT)location not on record	2
ZSMlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Natural History Museum, Londonlocation not on record	1

6 institutions · 19 of 29 vouchered records shown · 10 without an institution code

09Environmental DNA13 detections

Where the DNA of Acompsia schmidtiellus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 17.0–19.0

Seasonal swing summer↔winter16.0 °C

Max temp (day)21.7 °C 21.0–23.6

Min temp (night)13.2 °C 12.4–14.1

Precipitation71.6 mm/mo 53.1–102

Air humidity60.2 % 58.0–60.5

Moisture balance-47.2 mm/mo -73.1–-32.5

Vapour deficit823 Pa 754–922

Wind speed3.10 m/s 2.50–3.40

Cloud cover33.3 % 31.6–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)