Acompsia cinerella

(Clerck, 1759) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Acompsia

At a glance

Occurrence records12 136

Data sources10

Biological traits2

DNA specimens84

eDNA detections161

Sources10 archives

Databases and archives Acompsia cinerella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 136 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI161 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics84 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF12 136 records

Environmental DNA4 datasets · 14 countries161 detections

DNA & barcodingBOLD84 specimens

Genome at a glanceGoaT · NCBI≈396 Mbp

01Narrative

Acompsia cinerella, the ash-coloured sober, is a small lepidopteran species of the twirler moth family (Gelechiidae). It is the type species of the genus Acompsia, once assigned to the subfamily Anacampsinae but generally placed in the Dichomeridinae. The species was first described by Carl Alexander Clerck in 1759. Specimen from North Wales

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding84 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acompsia cinerella has left across the world's sequence archives.

At a glance

DNA specimens84

BINs1

Marker genes1

eDNA detections161

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus78 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

67Amostly conserved

73Amostly conserved

79Gmostly conserved

88Avariable

202Gmostly conserved

238Cmostly conserved

263Cmostly conserved

400Tmostly conserved

460Tmostly conserved

463Cmostly conserved

499Cmostly conserved

514Amostly conserved

517Amostly conserved

622Avariable

628Gvariable

646Cvariable

AACTCTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACCTCTTTAAGTCTTTTAATTCGAGCTGAATTGGGGAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.98%

Haplotypes33

BIN1

Most divergent pair2.9%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acompsia subpunctellasame genus3.5%Acompsia tripunctellasame genus5.8%Acompsia ponomarenkoaesame genus6.2%Acompsia baldizzoneisame genus6.8%Acompsia maculosellasame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acompsia cinerella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈396 161 209 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acompsia cinerella0.40 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.5% BUSCO

08Occurrence & distribution

Record type12 136 records

Wild obs. + sensor10 744

Museum / vouchered1 186

Other206

Origin

Native5

Range

Area of Occupancy AOO13 080 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 6 157≤1 km 2 259≤10 km 1 671>10 km 22

10 109 georeferenced · 635 without coordinates

Open the mapobservation + sensor10 744

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 447≤1 km 399≤10 km 161

1 007 georeferenced · 179 without coordinates

Open the institutions mapphysical evidence1 186

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	164
NHMOlocation not on record	133
Tartu, EE	95
SLU Artdatabankenlocation not on record	77
DanishLepidopterologicalSocietylocation not on record	51
Kuopio, FI	47
Stockholm, SE	42
Philadelphia, US	37
ZMAAlocation not on record	34
Salzburg, AT	27
European Distributed Institute of Taxonomy (EDIT)location not on record	24
Tallinn, EE	22
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	15
NTNU-VMlocation not on record	9
National Institute of Biological Resourceslocation not on record	7
Helsinki, FI	6
DABUHlocation not on record	6
ZSMlocation not on record	5
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	5
Rovaniemi, FI	5
South Kensington, GB	5
BioFokuslocation not on record	4
CBDClocation not on record	4
neflocation not on record	3
Nijmegen, NL	2
University of Kaiserslauternlocation not on record	2
Metsähallituslocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
MZLUlocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Natural History Museum, Londonlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Uniwersytet Łódzkilocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

34 institutions · 841 of 1 186 vouchered records shown · 345 without an institution code

09Environmental DNA161 detections

Where the DNA of Acompsia cinerella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found161

Studies independent surveys4

Countries14

Verifiable raw sequence linked69

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 161 detections have coordinates

Open the map14 countries0

01.1. Boreal Forest|1. Forest & WoodlandUrbanHay meadowmixed forest alleedry grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 11.7–20.5

Seasonal swing summer↔winter18.8 °C

Max temp (day)20.0 °C 15.8–24.6

Min temp (night)11.8 °C 5.60–15.9

Precipitation77.9 mm/mo 55.2–145

Air humidity59.8 % 55.7–62.9

Moisture balance-40.2 mm/mo -75.7–24.3

Vapour deficit717 Pa 537–1,012

Wind speed2.80 m/s 2.00–4.40

Cloud cover41.3 % 33.4–54.4

CHELSA 1981–2010, ~9 km grid, at location & month of 158 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acompsia cinerella

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type12 136 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type12 136 records