Acodontaster conspicuus

(Koehler, 1920) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Asteroidea/Valvatida/Odontasteridae/Acodontaster

At a glance

Occurrence records451

Data sources10

Biological traits3

DNA specimens21

eDNA detections13

Sources10 archives

Databases and archives Acodontaster conspicuus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility159 records↗

OBISOcean Biodiversity Information System292 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Chemical compositionLOTUS · NPASS54 compounds

Occurrence & distributionGBIF · OBIS451 records

Environmental DNA2 datasets · 2 countries13 detections

DNA & barcodingBOLD21 specimens

01Narrative

Acodontaster conspicuus is a species of starfish in the family Odontasteridae. It is found in the Southern Ocean, in the waters off Antarctica and the island groups nearby.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Depth min229 m

03Chemical composition54 compounds

Compounds documented for Acodontaster conspicuus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cholestane steroids21

Isoquinoline alkaloids $ Terpenoid tetrahydroisoquinoline alkaloids11

Cholestane steroids $ Stigmastane steroids4

Terpenoid tetrahydroisoquinoline alkaloids2

Secoiridoid monoterpenoids2

Documented compounds54 total

Tissue Source Quantified only

Compound	Amount	Source
(1R)-1-(((2S,3R,11bS)-3-Ethyl-1,3,4,6,7,11b-hexahydro-9,10-dimethoxy-2H-benzo(a)quinolizin-2-yl)methyl)-2,3,4,9-tetrahydro-1H-pyrido(3,4-b)indol-6-ol	present	NPASS
(1R,15S,16R,17S)-16-ethenyl-5-hydroxy-4-methoxy-15-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-14-oxa-10-azatetracyclo[8.8.0.02,7.012,17]octadeca-2,4,6,12-tetraen-11-one	present	NPASS
(2R,3R,11bS)-3-Ethyl-1,3,4,6,7,11b-hexahydro-9,10-dimethoxy-2H-benzo(a)quinolizine-2-acetaldehyde	present	NPASS
(2R,3R,4S,5R)-2-[(Z,6R)-3-propan-2-yl-6-[(3S,5S,6S,9R,10R,13R,15R,17R)-3,6,15-trihydroxy-10,13-dimethyl-2,3,4,5,6,7,9,11,12,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-17-yl]hept-2-enoxy]oxane-3,4,5-triol	present	LOTUS
(2S,3R,4S)-4-[[(1R)-2-acetyl-6,7-dihydroxy-3,4-dihydro-1H-isoquinolin-1-yl]methyl]-3-ethenyl-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,4-dihydro-2H-pyran-5-carboxylic acid	present	NPASS
(2S,3S,11Bs)-2-[[(1R)-6,7-Dimethoxy-1,2,3,4-Tetrahydroisoquinolin-1-Yl]Methyl]-3-Ethyl-9,10-Dimethoxy-2,3,4,6,7,11B-Hexahydro-1H-Benzo[A]Quinolizine	present	NPASS
(3S,4R,5S,6S,8S,9R,10S,13R,14S,15R,17R)-17-[(2R,5R)-5-[2-[(2R,3R,4S,5R)-3-[(2S,3R,4S,5R)-4,5-dihydroxy-3-methoxyoxan-2-yl]oxy-4,5-dihydroxyoxan-2-yl]oxyethyl]-6-methylheptan-2-yl]-10,13-dimethyl-1,2,3,4,5,6,7,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthrene-3,4,6,8,15-pentol	present	LOTUS
(3S,4R,5S,6S,8S,9R,10S,13R,14S,15R,17R)-17-[(2R,6S)-7-[(2R,3R,4S,5R)-3-[(2S,3R,4S,5R)-4,5-dihydroxy-3-methoxyoxan-2-yl]oxy-4,5-dihydroxyoxan-2-yl]oxy-6-methyl-5-methylideneheptan-2-yl]-10,13-dimethyl-1,2,3,4,5,6,7,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthrene-3,4,6,8,15-pentol	present	LOTUS
(3S,4R,5S,6S,8S,9R,10S,13R,14S,15R,17R)-17-[(E,2R,5R)-5-hydroxy-6-methylhept-3-en-2-yl]-10,13-dimethyl-1,2,3,4,5,6,7,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthrene-3,4,6,8,15-pentol	present	LOTUS
(3S,4R,5S,6S,8S,9R,10S,13R,14S,15R,17R)-17-[(E,2R,5R)-6-hydroxy-5-methylhex-3-en-2-yl]-10,13-dimethyl-1,2,3,4,5,6,7,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthrene-3,4,6,8,15-pentol	present	LOTUS

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acodontaster conspicuus has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes2

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Diversity (π)4.8%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 78 variable positions, in barcode order

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

43Cmostly conserved

44Amostly conserved

47Gmostly conserved

48Cmostly conserved

49Amostly conserved

51Tmostly conserved

52Gmostly conserved

53Amostly conserved

54Gmostly conserved

56Gmostly conserved

58Amostly conserved

61Cmostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

69Cmostly conserved

71Gmostly conserved

72Amostly conserved

73Amostly conserved

74Cmostly conserved

75Tmostly conserved

76Tmostly conserved

77Gmostly conserved

78Cmostly conserved

79Cmostly conserved

81Amostly conserved

82Gmostly conserved

83Cmostly conserved

84Cmostly conserved

85Amostly conserved

86Gmostly conserved

87Gmostly conserved

89Tmostly conserved

90Cmostly conserved

91Cmostly conserved

96Tmostly conserved

97Tmostly conserved

98Cmostly conserved

100Amostly conserved

115Cvariable

127Tmostly conserved

133Cmostly conserved

157Tmostly conserved

163Gmostly conserved

190Gmostly conserved

208Cmostly conserved

238Tmostly conserved

268Cmostly conserved

280Tmostly conserved

289Tmostly conserved

298Tmostly conserved

318Cmostly conserved

358Amostly conserved

403Gmostly conserved

445Cmostly conserved

451Tmostly conserved

454Amostly conserved

479Amostly conserved

487Tmostly conserved

493Gmostly conserved

502Amostly conserved

508Cmostly conserved

544Amostly conserved

580Gmostly conserved

595Amostly conserved

622Cmostly conserved

637Tvariable

649Gmostly conserved

AACCCTTTATCTTATATTTGGAGCATGAGCTGGAATGGTAGGCACAGCAATGAGAGTAATCATACGAACAGAACTTGCCCAGCCAGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acodontaster capitatussame genus3.5%Acodontaster hodgsonisame genus5.8%Acodontaster elongatussame genus5.9%Odontaster pearseisame family7.0%Odontaster penicillatussame family7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type451 records

Wild obs. + sensor225

Museum / vouchered218

Other8

Range

Area of Occupancy AOO776 km²

Depth

0–200 m sunlit35

200–1000 m twilight94

1–4 km midnight1

>4 km abyssal0

median 290 m · max 2 960 m · 130 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 26≤1 km 13≤10 km 2

41 georeferenced · 184 without coordinates

Open the mapobservation + sensor225

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 25≤1 km 14≤10 km 5>10 km 1

45 georeferenced · 173 without coordinates

Open the institutions mapphysical evidence218

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	32
Earth Sciences New Zealandlocation not on record	15
Universite Libre de Bruxelleslocation not on record	15
ULB, BIOMARlocation not on record	14
CASlocation not on record	6
Paris, FR	5
South Kensington, GB	5
Montgomery, US	4
AADClocation not on record	4
Buenos Aires, AR	3
Alabama Museum of Natural Historylocation not on record	2
Université de Liègelocation not on record	1
Museo nazionale dell'Antartidelocation not on record	1

13 institutions · 107 of 218 vouchered records shown · 1 without an institution code

09Environmental DNA13 detections

Where the DNA of Acodontaster conspicuus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys2

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

Mexico, Gulf of

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-4.40 °C -16.8–4.20

Seasonal swing summer↔winter22.2 °C

Max temp (day)-3.50 °C -14.8–4.90

Min temp (night)-5.20 °C -18.7–3.50

Precipitation45.5 mm/mo 24.0–134

Air humidity64.9 % 57.1–72.0

Vapour deficit185 Pa 69.3–327

Cloud cover64.4 % 47.2–65.9

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)