Aclytia punctata

Butler, 1876 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Aclytia

At a glance

Occurrence records521

Data sources6

Biological traits0

DNA specimens81

eDNA detections71

Sources6 archives

Databases and archives Aclytia punctata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility521 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI71 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics81 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF521 records

Environmental DNA1 datasets · 4 countries71 detections

DNA & barcodingBOLD81 specimens

01Narrative

Aclytia punctata is a moth of the family Erebidae. It was described by Arthur Gardiner Butler in 1876. It is found in Honduras, Guatemala, Costa Rica and Brazil (Pará).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding81 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aclytia punctata has left across the world's sequence archives.

At a glance

DNA specimens81

BINs3

Marker genes1

eDNA detections71

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus79 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

37Amostly conserved

130Cmostly conserved

154Tmostly conserved

157Gmostly conserved

166Tmostly conserved

271Tmostly conserved

334Cmostly conserved

403Tmostly conserved

439Cmostly conserved

565Cmostly conserved

613Cmostly conserved

631Tmostly conserved

634Tmostly conserved

ATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGACTATTAATTCGAGCTGAATTAGGAAATCCTGGTTCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.71%

Haplotypes24

BINs3

Most divergent pair4.0%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hermierius testaceussame family5.8%Aclytia hebersame genus5.8%Eucereon consortasame family6.0%Eucereon pometinasame family6.1%Aclytia albistrigasame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type521 records

Wild obs. + sensor47

Museum / vouchered474

Range

Area of Occupancy AOO532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 21≤1 km 7≤10 km 3>10 km 1

32 georeferenced · 15 without coordinates

Open the mapobservation + sensor47

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 15

15 georeferenced · 459 without coordinates

Open the institutions mapphysical evidence474

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	433
Mississippi State, US	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
University of Vienna, Dept of Botany and Biodiversity Researchlocation not on record	2
Ciudad de México, MX	2
Mexico City, MX	1
Cornell University Insect Collectionlocation not on record	1

7 institutions · 445 of 474 vouchered records shown · 29 without an institution code

09Environmental DNA71 detections

Where the DNA of Aclytia punctata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found71

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 71 detections have coordinates

Open the map4 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 23.2–25.7

Seasonal swing summer↔winter1.20 °C

Max temp (day)25.8 °C 25.8–28.8

Min temp (night)20.9 °C 20.9–23.2

Precipitation551 mm/mo 302–551

Air humidity75.3 % 70.1–75.3

Moisture balance435 mm/mo 179–435

Vapour deficit697 Pa 697–1,008

Wind speed0.7 m/s 0.7–2.30

Cloud cover40.9 % 34.2–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 71 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)