Acizzia hakeae

(Tuthill, 1952) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Psyllidae/Acizzia

At a glance

Occurrence records10

Data sources6

Biological traits0

DNA specimens10

eDNA detections2

Sources6 archives

Databases and archives Acizzia hakeae's data was compiled from.

GBIFGlobal Biodiversity Information Facility10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF10 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD10 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acizzia hakeae has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes2

eDNA detections2

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P461 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

23Gmostly conserved

40Cmostly conserved

43Amostly conserved

73Avariable

121Tmostly conserved

127Avariable

133Tmostly conserved

163Amostly conserved

178Amostly conserved

208Cvariable

449Tmostly conserved

450Amostly conserved

ACTTGTCCCCTTGATAATTGGAGCTCCTGATATAGCTTTCCCACGACTTAACAATTTAAGATTCTGACTTTTAATTCCTTCCCTATATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes4

BIN1

Most divergent pair2.2%

OceaniaOtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cacopsylla pyrisugasame family17.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type10 records

Wild obs. + sensor9

Museum / vouchered1

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 5>10 km 2

7 georeferenced · 2 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA2 detections

Where the DNA of Acizzia hakeae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)