Acizzia dodonaeae

(Tuthill, 1952) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Psyllidae/Acizzia

At a glance

Occurrence records16

Data sources7

Biological traits0

DNA specimens12

eDNA detections1

Sources7 archives

Databases and archives Acizzia dodonaeae's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF16 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD12 specimens

01Narrative

Acizzia dodonaeae is a psyllid common on Dodonaea viscosa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acizzia dodonaeae has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes2

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P395 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 61 variable positions, in barcode order

3Cmostly conserved

12Cmostly conserved

15Amostly conserved

16Tmostly conserved

24Cmostly conserved

27Amostly conserved

54Cmostly conserved

55Cmostly conserved

75Tmostly conserved

81Amostly conserved

90Amostly conserved

99Amostly conserved

102Tmostly conserved

109Amostly conserved

111Tmostly conserved

114Gmostly conserved

120Tmostly conserved

126Amostly conserved

129Tmostly conserved

132Amostly conserved

138Cmostly conserved

141Gmostly conserved

142Gmostly conserved

156Tmostly conserved

159Cmostly conserved

165Cmostly conserved

168Tmostly conserved

171Cmostly conserved

198Cmostly conserved

201Cmostly conserved

213Tmostly conserved

222Amostly conserved

231Amostly conserved

243Gmostly conserved

246Cmostly conserved

252Tmostly conserved

255Amostly conserved

261Amostly conserved

273Gmostly conserved

276Cmostly conserved

282Cmostly conserved

285Cmostly conserved

286Cmostly conserved

288Tmostly conserved

291Tmostly conserved

295Cmostly conserved

297Tmostly conserved

309Amostly conserved

310Tmostly conserved

315Tmostly conserved

324Tmostly conserved

334Cmostly conserved

342Tmostly conserved

348Cmostly conserved

360Tmostly conserved

363Tmostly conserved

372Amostly conserved

375Tmostly conserved

378Gvariable

387Cmostly conserved

394Cmostly conserved

AACTTAAGATTCTGATTATTAATCCCATCGTTATATCTTTTAATTATAAGAAGCCTAATTGATCAAGGAGTAGGTACAGGATGAACTGTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes5

BIN1

Most divergent pair15.2%

Oceania

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type16 records

Wild obs. + sensor14

Museum / vouchered2

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 8≤1 km 1>10 km 1

10 georeferenced · 4 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
MWLRlocation not on record	2

1 institutions · 2 of 2 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Acizzia dodonaeae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)