Acizzia conspicua

(Tuthill, 1952) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Psyllidae/Acizzia

At a glance

Occurrence records38

Data sources6

Biological traits0

DNA specimens5

eDNA detections1

Sources6 archives

Databases and archives Acizzia conspicua's data was compiled from.

GBIFGlobal Biodiversity Information Facility38 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF38 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD5 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acizzia conspicua has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes2

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P454 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.15%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

376Avariable

TTTAATAATTGGAGCTCCAGATATAGCTTTCCCCCGACTTAACAATTTAAGATTTTGATTACTCATTCCTTCATTATACCTACTCATCAT …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type38 records

Wild obs. + sensor22

Museum / vouchered16

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 15≤1 km 2>10 km 3

20 georeferenced · 2 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 13≤1 km 2

15 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Tasmanian Museum & Art Gallerylocation not on record	15

1 institutions · 15 of 16 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Acizzia conspicua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)