Aciurina trixa

Curran, 1932 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Aciurina

At a glance

Occurrence records881

Data sources7

Biological traits0

DNA specimens16

eDNA detections2

Sources7 archives

Databases and archives Aciurina trixa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility881 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF881 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD16 specimens

01Narrative

Aciurina trixa is a species of tephritid or fruit flies in the genus Aciurina of the family Tephritidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aciurina trixa has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

40Cmostly conserved

46Cmostly conserved

90Cmostly conserved

93Cmostly conserved

126Gmostly conserved

192Cmostly conserved

216Cmostly conserved

234Amostly conserved

237Cmostly conserved

279Tmostly conserved

282Amostly conserved

306Tmostly conserved

434Gmostly conserved

484Gmostly conserved

496Cmostly conserved

537Cmostly conserved

544Tmostly conserved

582Tmostly conserved

633Tmostly conserved

ATAATTGGAACTTCATTAAGAGTTATTATTCGAGCTGAACTAGGTCACCCAGGAACTTTAATCGGAAATGATCAAATTTATAATGTAATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes5

BIN1

Most divergent pair2.2%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eurosta solidaginissame family8.5%Eurosta fenestratasame family9.3%Eurosta cribatasame family9.8%Euarestoides acutangulussame family11.3%Tephritis dioscureasame family11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type881 records

Wild obs. + sensor773

Museum / vouchered108

Range

Area of Occupancy AOO1 536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 475≤1 km 58≤10 km 14>10 km 107

654 georeferenced · 119 without coordinates

Open the mapobservation + sensor773

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence108

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Albuquerque, US	106
ASUlocation not on record	2

2 institutions · 108 of 108 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Aciurina trixa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)