Aciurina bigeloviae

(Cockerell, 1890) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Aciurina

At a glance

Occurrence records1 793

Data sources7

Biological traits0

DNA specimens25

eDNA detections41

Sources7 archives

Databases and archives Aciurina bigeloviae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 793 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 793 records

Environmental DNA1 datasets · 2 countries41 detections

DNA & barcodingBOLD25 specimens

01Narrative

Aciurina bigeloviae is a species of tephritid or fruit flies in the genus Aciurina of the family Tephritidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aciurina bigeloviae has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections41

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

40Cmostly conserved

48Cmostly conserved

126Avariable

153Tmostly conserved

189Cmostly conserved

229Tmostly conserved

234Gvariable

237Tvariable

282Amostly conserved

306Cmostly conserved

420Tmostly conserved

484Gmostly conserved

537Cmostly conserved

544Cvariable

ATAATTGGAACTTCATTAAGAGTTATTATTCGAGCTGAACTAGGTCACCCAGGAACTTTAATCGGAAATGATCAAATTTATAATGTAATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes15

BIN1

Most divergent pair1.7%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eurosta solidaginissame family8.5%Eurosta fenestratasame family9.0%Eurosta cribatasame family9.8%Paracantha gentilissame family11.1%Campiglossa hirayamaesame family11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 793 records

Wild obs. + sensor1 686

Museum / vouchered107

Range

Area of Occupancy AOO4 044 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 088≤1 km 121≤10 km 53>10 km 130

1 392 georeferenced · 294 without coordinates

Open the mapobservation + sensor1 686

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤1 km 7≤10 km 12>10 km 5

24 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence107

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Albuquerque, US	80
Essig Museum of Entomologylocation not on record	18
Provo, US	7
ASUlocation not on record	1

4 institutions · 106 of 107 vouchered records shown · 1 without an institution code

09Environmental DNA41 detections

Where the DNA of Aciurina bigeloviae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map2 countries0

5. Wetlands (inland)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 16.5–17.8

Seasonal swing summer↔winter22.9 °C

Max temp (day)24.4 °C 23.6–24.8

Min temp (night)9.80 °C 9.00–10.9

Precipitation29.2 mm/mo 28.6–34.2

Air humidity47.3 % 44.5–51.2

Moisture balance-134 mm/mo -141–-109

Vapour deficit1,046 Pa 997–1,058

Wind speed2.60 m/s 2.30–3.50

Cloud cover37.1 % 25.4–38.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aciurina bigeloviae

At a glance

Sources7 archives

At a glance

Record type1 793 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 793 records