Aciura coryli

(Rossi, 1794) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Aciura

At a glance

Occurrence records206

Data sources6

Biological traits0

DNA specimens5

eDNA detections2

Sources6 archives

Databases and archives Aciura coryli's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility206 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF206 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD5 specimens

01Narrative

Aciura coryli fly on Ballota nigra, in Bucharest, Romania Aciura coryli is a species of tephritid or fruit flies in the genus Aciura of the family Tephritidae. The larvae of this species live in flowers of Phlomis and Ballota (Labiatae). Its distribution encompasses the entire Mediterranean region, where it is often collected in locations with large stocks of host plants. In contrast, the published finds from Central Europe (Austria, Hungary, Czech Republic) are old and the species has not been confirmed in these countries in recent decades. The present relatively modern evidence deserves our attention because it is evidence of the still existing occurrence in Central Europe. - The plant genus Phlomis does not occur in East Tyrol (FISCHER et al. 2005), Ballota nigra occasionally in the valley of Lienz and near Virgen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aciura coryli has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections2

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.06%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

346Cmostly conserved

AACATTATATTTTATTTTTGGTGCATGAGCAGGAATAATCGGTACTTCATTAAGAATCCTAATTCGAGCTGAATTAGGACATCCAGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphaeniscus sexmaculatussame family7.6%Dicheniotes erosasame family7.8%Sphaeniscus atiliussame family8.4%Oxyaciura tibialissame family8.9%Tephritis hyoscyamisame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type206 records

Wild obs. + sensor184

Museum / vouchered22

Range

Area of Occupancy AOO560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 43≤1 km 10≤10 km 26>10 km 4

83 georeferenced · 101 without coordinates

Open the mapobservation + sensor184

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 1≤10 km 9>10 km 5

15 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	16
Washington, US	5
European Distributed Institute of Taxonomy (EDIT)location not on record	1

3 institutions · 22 of 22 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Aciura coryli was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 16.8–18.0

Seasonal swing summer↔winter20.8 °C

Max temp (day)21.6 °C 20.9–22.3

Min temp (night)11.8 °C 11.0–12.5

Precipitation113 mm/mo 90.2–136

Air humidity59.9 % 58.6–61.2

Moisture balance-14.1 mm/mo -52.0–23.7

Vapour deficit799 Pa 795–803

Wind speed2.20 m/s 1.90–2.60

Cloud cover36.0 % 34.9–37.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)