Acinopterus angulatus

Lawson, 1922 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Acinopterus

At a glance

Occurrence records67

Data sources6

Biological traits0

DNA specimens101

eDNA detections102

Sources6 archives

Databases and archives Acinopterus angulatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility67 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI102 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics101 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF67 records

Environmental DNA1 datasets · 1 countries102 detections

DNA & barcodingBOLD101 specimens

01Narrative

Acinopterus angulatus, the angulate leafhopper, is a species of leafhopper in the family Cicadellidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding101 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acinopterus angulatus has left across the world's sequence archives.

At a glance

DNA specimens101

BINs4

Marker genes1

eDNA detections102

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus99 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

19Gmostly conserved

73Tmostly conserved

100Cmostly conserved

265Avariable

400Cmostly conserved

415Tmostly conserved

496Cvariable

CTTATACTTTATATTTGGGATCTGATCAGGAATAGTAGGAATAATATTGAGAATAATTATTCGAATAGAACTTGCTCAACCAGGACCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 45 variants.

Diversity (π)1.4%

Haplotypes45

BINs4

Most divergent pair15.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Maiestas heuksandoensissame family14.4%Acinopterus viridissame genus14.9%Elymana sulphurellasame family15.3%Deltocephalus vulgarissame family15.5%Gloridonus vetulussame family15.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type67 records

Wild obs. + sensor16

Museum / vouchered51

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 8≤1 km 1>10 km 3

12 georeferenced · 4 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 3

6 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina State University Insect Museumlocation not on record	20
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	16
Champaign, US	8
Provo, US	2
Washington, US	1
US	1
Essig Museum of Entomologylocation not on record	1
OSUClocation not on record	1
Mexico City, MX	1

9 institutions · 51 of 51 vouchered records shown

09Environmental DNA102 detections

Where the DNA of Acinopterus angulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found102

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 102 detections have coordinates

Open the map1 country0

14. Artificial - Terrestrial|14.5 Urban Areas1. Forest & Woodland|1.4. Temperate Forest3. Shrubland | 3.4. Temperate Shrubland3. Shrubland|3.8. Mediterranean-type Shrubby…1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 14.2–28.5

Seasonal swing summer↔winter17.3 °C

Max temp (day)33.1 °C 18.1–36.4

Min temp (night)18.8 °C 10.3–21.4

Precipitation9.70 mm/mo 2.00–61.4

Air humidity47.1 % 40.8–56.0

Moisture balance-160 mm/mo -200–14.7

Vapour deficit1,760 Pa 629–2,332

Wind speed2.60 m/s 1.50–5.20

Cloud cover14.5 % 11.8–39.0

CHELSA 1981–2010, ~9 km grid, at location & month of 98 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)