Acinopterus acuminatus

Van Duzee, 1892 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Acinopterus

At a glance

Occurrence records214

Data sources5

Biological traits0

DNA specimens10

eDNA detections10

Sources5 archives

Databases and archives Acinopterus acuminatus's data was compiled from.

GBIFGlobal Biodiversity Information Facility214 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF214 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD10 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acinopterus acuminatus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

67Tmostly conserved

184Gmostly conserved

200Tmostly conserved

208Cmostly conserved

287Cmostly conserved

334Amostly conserved

343Amostly conserved

386Cmostly conserved

394Cmostly conserved

428Tmostly conserved

436Cmostly conserved

460Tmostly conserved

468Gmostly conserved

484Tmostly conserved

517Tmostly conserved

532Amostly conserved

536Tmostly conserved

616Cmostly conserved

620Gmostly conserved

628Gmostly conserved

GACCTTATATTTTTTATTTGGTATCTGAGCAGGAATAGTGGGAATAATACTAAGAATAATTATTCGTATAGAGTTAGCTCAACCAGGACC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.89%

Haplotypes7

BIN1

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Maiestas heuksandoensissame family16.2%Cicadula melanogastersame family16.8%Cicadula intermediasame family17.1%Texananus dolussame family17.2%Scaphytopius magdalensissame family17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type214 records

Wild obs. + sensor45

Museum / vouchered169

Range

Area of Occupancy AOO348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 19≤1 km 8>10 km 6

33 georeferenced · 12 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 17≤1 km 26≤10 km 76

119 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence169

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	102
Mississippi State, US	64
Montgomery, US	3

3 institutions · 169 of 169 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Acinopterus acuminatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.6 °C 25.9–27.6

Seasonal swing summer↔winter23.4 °C

Max temp (day)33.2 °C 31.3–33.2

Min temp (night)23.1 °C 21.6–23.1

Precipitation89.9 mm/mo 89.9–104

Air humidity59.1 % 58.9–59.1

Moisture balance-85.7 mm/mo -85.7–-76.2

Vapour deficit1,510 Pa 1,390–1,510

Wind speed2.20 m/s 2.20–3.40

Cloud cover29.3 % 29.3–31.8

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)