Acinia corniculata

(Zetterstedt, 1819) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Acinia

At a glance

Occurrence records408

Data sources6

Biological traits2

DNA specimens9

eDNA detections6

Sources6 archives

Databases and archives Acinia corniculata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility408 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF408 records

Environmental DNA1 datasets · 4 countries6 detections

DNA & barcodingBOLD9 specimens

01Narrative

Acinia corniculata, is a species of fruit fly in the family Tephritidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acinia corniculata has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections6

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TACATTATATTTTATTTTTGGAGCTTGAGCAGGAATAATTGGTACATCATTAAGAATTTTAATTCGAACTGAATTAGGTCACCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trupanea femoralissame family4.9%Trupanea radiferasame family5.4%Trupanea nigricornissame family5.8%Acanthiophilus helianthisame family5.9%Trupanea stellatasame family5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type408 records

Wild obs. + sensor286

Museum / vouchered122

Range

Area of Occupancy AOO1 084 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 133≤1 km 68≤10 km 58>10 km 4

263 georeferenced · 23 without coordinates

Open the mapobservation + sensor286

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 54≤1 km 15≤10 km 22

91 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence122

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	37
MZLUlocation not on record	19
Helsinki, FI	8
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	7
BioFokuslocation not on record	6
Philadelphia, US	6
NHMOlocation not on record	6
Washington, US	6
University of Tokyo, Department of Zoologylocation not on record	5
South Kensington, GB	3
DFFW2016location not on record	2
Gothenburg, SE	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
Tromsø, NO	1
Natural History Museum Rotterdamlocation not on record	1

15 institutions · 109 of 122 vouchered records shown · 13 without an institution code

09Environmental DNA6 detections

Where the DNA of Acinia corniculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 11.9–17.6

Seasonal swing summer↔winter20.6 °C

Max temp (day)20.2 °C 14.3–21.2

Min temp (night)12.4 °C 8.00–13.7

Precipitation77.9 mm/mo 71.9–112

Air humidity60.3 % 58.5–64.2

Moisture balance-32.2 mm/mo -49.9–15.9

Vapour deficit773 Pa 519–821

Wind speed3.00 m/s 2.70–4.10

Cloud cover42.8 % 38.3–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)