Acila mirabilis

(A.Adams & Reeve, 1850) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Nuculida/Nuculidae/Acila

At a glance

Occurrence records357

Data sources5

Biological traits2

DNA specimens9

eDNA detections9

Sources5 archives

Databases and archives Acila mirabilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility170 records↗

OBISOcean Biodiversity Information System187 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS357 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Acila mirabilis is een tweekleppigensoort uit de familie van de Nuculidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1850 door Adams & Reeve.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acila mirabilis has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 60 variable positions, in barcode order

7Avariable

19Cmostly conserved

31Gmostly conserved

34Cmostly conserved

40Tmostly conserved

50Tmostly conserved

55Amostly conserved

61Amostly conserved

79Amostly conserved

109Gmostly conserved

157Cmostly conserved

160Amostly conserved

166Amostly conserved

181Gmostly conserved

190Amostly conserved

196Gmostly conserved

199Gmostly conserved

214Tmostly conserved

220Amostly conserved

226Tvariable

229Amostly conserved

235Cmostly conserved

253Amostly conserved

268Tmostly conserved

271Tmostly conserved

287Tmostly conserved

292Amostly conserved

313Amostly conserved

319Cmostly conserved

322Tmostly conserved

325Tmostly conserved

328Tmostly conserved

334Tmostly conserved

343Amostly conserved

352Amostly conserved

359Tmostly conserved

361Amostly conserved

364Cmostly conserved

373Amostly conserved

407Tmostly conserved

412Tmostly conserved

433Tmostly conserved

437Gmostly conserved

439Amostly conserved

457Tmostly conserved

478Amostly conserved

485Tmostly conserved

496Cmostly conserved

508Cmostly conserved

523Tmostly conserved

533Tmostly conserved

539Tmostly conserved

562Tmostly conserved

574Cmostly conserved

578Tmostly conserved

581Cmostly conserved

604Cmostly conserved

619Amostly conserved

634Tmostly conserved

641Tmostly conserved

AACACTATATCTTTTATTCGGTATTTGATCGGGCCTAGTTGGAACTTCATTAAGATTACTAATTCGAGCAGAATTAGGACAACCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes7

BINs2

Most divergent pair1.2%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acila divaricatasame genus12.1%Acila castrensissame genus12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type357 records

Wild obs. + sensor265

Museum / vouchered92

Range

Area of Occupancy AOO412 km²

Depth

0–200 m sunlit7

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 70 m · max 182.9 m · 7 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 262 without coordinates

Open the mapobservation + sensor265

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 3≤10 km 2>10 km 4

9 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence92

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Toyama, JP	11
Santa Barbara Museum of Natural Historylocation not on record	10
Philadelphia, US	6
Cambridge, US	2
Nishinomiya Shell Museumlocation not on record	2
Denver, US	1
Wakayama Prefectural Museum of Natural Historylocation not on record	1

7 institutions · 33 of 92 vouchered records shown · 2 without an institution code

09Environmental DNA9 detections

Where the DNA of Acila mirabilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 8.40–16.6

Seasonal swing summer↔winter24.2 °C

Max temp (day)15.2 °C 10.7–19.6

Min temp (night)7.80 °C 4.00–11.7

Precipitation254 mm/mo 181–326

Air humidity62.6 % 60.8–64.5

Moisture balance148 mm/mo 55.4–240

Vapour deficit614 Pa 465–764

Wind speed3.10 m/s 2.90–3.20

Cloud cover44.1 % 43.7–44.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)