Acidota subcarinata

Erichson, 1840 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Acidota

At a glance

Occurrence records167

Data sources5

Biological traits0

DNA specimens23

eDNA detections16

Sources5 archives

Databases and archives Acidota subcarinata's data was compiled from.

GBIFGlobal Biodiversity Information Facility167 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF167 records

Environmental DNA1 datasets · 2 countries16 detections

DNA & barcodingBOLD23 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acidota subcarinata has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P642 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 92 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

6Tmostly conserved

7Gmostly conserved

9Amostly conserved

10Tmostly conserved

11Tmostly conserved

14Amostly conserved

16Cmostly conserved

17Tmostly conserved

18Tmostly conserved

21Gmostly conserved

23Gmostly conserved

24Cmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

34Tvariable

35Amostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

46Tmostly conserved

47Tmostly conserved

48Cmostly conserved

49Cmostly conserved

50Cmostly conserved

51Tmostly conserved

52Tmostly conserved

54Gmostly conserved

55Amostly conserved

56Amostly conserved

58Cmostly conserved

59Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Cmostly conserved

65Cmostly conserved

66Gmostly conserved

67Tmostly conserved

69Cmostly conserved

70Cmostly conserved

71Gmostly conserved

72Amostly conserved

73Amostly conserved

74Cmostly conserved

75Tmostly conserved

76Gvariable

77Gmostly conserved

78Gmostly conserved

79Tvariable

80Amostly conserved

81Amostly conserved

82Tmostly conserved

83Cmostly conserved

84Cmostly conserved

88Amostly conserved

106Tvariable

118Tmostly conserved

157Tmostly conserved

163Tvariable

181Avariable

193Tmostly conserved

226Tvariable

271Cmostly conserved

283Tmostly conserved

286Avariable

304Avariable

316Amostly conserved

331Avariable

343Cvariable

346Cvariable

370Gvariable

373Avariable

482Avariable

535Avariable

538Amostly conserved

544Gvariable

562Amostly conserved

571Tmostly conserved

628Gmostly conserved

631Amostly conserved

AACTTTGTATTTCATCTTTGGTGCTTGAGCTGGTATAGTAGGTACTTCCCTTAGAATCTTAATCCGTGCCGAACTGGGTAATCCAGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes4

BIN1

Most divergent pair2.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arpedium cribratumsame family12.1%Arpedium brachypterumsame family12.3%Arpedium brunnescenssame family12.4%Arpedium quadrumsame family12.5%Acidota quadratasame genus12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type167 records

Wild obs. + sensor112

Museum / vouchered55

Range

Area of Occupancy AOO488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 56≤1 km 17≤10 km 4>10 km 9

86 georeferenced · 26 without coordinates

Open the mapobservation + sensor112

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤1 km 11≤10 km 16

27 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Tennessee at Chattanoogalocation not on record	16
Helsinki, FI	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
University of Guelphlocation not on record	8
University Park, US	3
WIlocation not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Cambridge, US	1
Espace pour la vielocation not on record	1
Saint John, CA	1

10 institutions · 53 of 55 vouchered records shown · 2 without an institution code

09Environmental DNA16 detections

Where the DNA of Acidota subcarinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map2 countries0

Black Spruce ForestForest1. Forest & Woodland|1.4. Temperate ForestTemperate mixed forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 7.50–12.5

Seasonal swing summer↔winter26.1 °C

Max temp (day)14.1 °C 12.4–17.3

Min temp (night)10.2 °C 3.70–11.1

Precipitation104 mm/mo 79.9–105

Air humidity60.4 % 55.9–60.5

Moisture balance32.2 mm/mo -29.8–52.1

Vapour deficit548 Pa 442–599

Wind speed2.90 m/s 2.80–4.10

Cloud cover57.2 % 44.7–58.2

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)