Achryson surinamum

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Achryson

At a glance

Occurrence records1 040

Data sources7

Biological traits0

DNA specimens10

eDNA detections2

Sources7 archives

Databases and archives Achryson surinamum's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 040 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 040 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD10 specimens

01Narrative

Achryson surinamum is a species of longhorn beetle in the Cerambycinae subfamily. It was described by Carl Linnaeus in his 1767 12th edition of Systema Naturae.Bezark, Larry G. A Photographic Catalog of the Cerambycidae of the World. It is known from southwestern United States, Argentina, Baja California, and the West Indies.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achryson surinamum has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections2

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 67 variable positions, in barcode order

2Tmostly conserved

11Amostly conserved

28Cmostly conserved

47Tmostly conserved

56Cvariable

71Cmostly conserved

79Tmostly conserved

85Gvariable

88Cmostly conserved

89Tmostly conserved

127Cmostly conserved

151Cmostly conserved

167Gmostly conserved

202Cvariable

205Gmostly conserved

208Gvariable

217Tmostly conserved

220Tmostly conserved

241Amostly conserved

244Cmostly conserved

253Gmostly conserved

265Gvariable

268Cmostly conserved

274Cmostly conserved

280Amostly conserved

284Cmostly conserved

355Tmostly conserved

388Amostly conserved

397Avariable

403Cmostly conserved

404Cmostly conserved

409Tmostly conserved

412Tmostly conserved

418Tvariable

427Amostly conserved

454Tmostly conserved

466Gmostly conserved

469Tmostly conserved

470Gmostly conserved

471Tmostly conserved

475Cmostly conserved

484Amostly conserved

505Amostly conserved

514Tmostly conserved

517Cmostly conserved

529Tmostly conserved

530Tmostly conserved

539Tmostly conserved

547Tmostly conserved

550Cmostly conserved

553Cvariable

556Tmostly conserved

571Avariable

575Cmostly conserved

577Amostly conserved

578Tmostly conserved

592Tmostly conserved

601Tmostly conserved

607Cmostly conserved

613Tmostly conserved

631Tmostly conserved

634Tmostly conserved

638Tmostly conserved

643Tmostly conserved

646Amostly conserved

649Tvariable

650Tmostly conserved

CTTATACTTCATTTTTGGAGCATGGGCCGGAATAGTAGGAACATCATTAAGAGTTCTAATTCGATCAGAACTAGGAAATCCAGGGTCCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.2%

Haplotypes3

BINs2

Most divergent pair9.2%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eburia octomaculatasame family15.1%Eburia quadrigeminatasame family15.4%Phaleria gracilipessame order15.7%Perissus kimisame family15.9%Notolaemus unifasciatussame order15.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 040 records

Wild obs. + sensor793

Museum / vouchered247

Range

Area of Occupancy AOO2 464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 374≤1 km 122≤10 km 59>10 km 65

620 georeferenced · 173 without coordinates

Open the mapobservation + sensor793

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 32≤1 km 7≤10 km 31>10 km 8

78 georeferenced · 169 without coordinates

Open the institutions mapphysical evidence247

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	45
National Biodiversity Institute, Costa Ricalocation not on record	43
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	35
College Station, US	26
South Kensington, GB	16
Museo Entomologico de Leonlocation not on record	13
Mexico City, MX	10
Corporación Colombiana de Investigación Agropecuaria - AGROSAVIAlocation not on record	7
MZFSlocation not on record	5
The University of the West Indies, Trinidad and Tobagolocation not on record	4
Washington, US	4
Natural History Museum of Utahlocation not on record	2
Lubbock, US	2
Universidad de Sucre (UniSucre)location not on record	2
UFFSlocation not on record	2
San Diego, US	2
Australian National Insect Collectionlocation not on record	2
MZLUlocation not on record	2
Durango, MX	2
Santa Barbara Museum of Natural Historylocation not on record	1
Wuzhou, CN	1
BAHIA, MZFSlocation not on record	1
University, National Zoological Collection of Surinamelocation not on record	1
Tapachula, MX	1
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
R, MZUELlocation not on record	1
University of Alabamalocation not on record	1
PUC-RSlocation not on record	1
Chicago, US	1

30 institutions · 235 of 247 vouchered records shown · 12 without an institution code

09Environmental DNA2 detections

Where the DNA of Achryson surinamum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 24.1–25.0

Seasonal swing summer↔winter4.20 °C

Max temp (day)27.9 °C 27.7–28.0

Min temp (night)21.3 °C 20.0–22.6

Precipitation50.5 mm/mo 14.0–86.9

Air humidity60.0 % 58.9–61.2

Moisture balance-113 mm/mo -144–-81.5

Vapour deficit1,227 Pa 1,227–1,227

Wind speed4.50 m/s 3.50–5.50

Cloud cover32.8 % 18.7–46.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Achryson surinamum

At a glance

Sources7 archives

At a glance

Record type1 040 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 040 records