Achrosis incitata

(Walker, 1862) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Achrosis

At a glance

Occurrence records67

Data sources7

Biological traits0

DNA specimens12

eDNA detections1

Sources7 archives

Databases and archives Achrosis incitata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility67 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF67 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD12 specimens

01Narrative

Achrosis incitata is a species of moth of the family Geometridae first described by Francis Walker in 1862. It is found in Asia, including the Himalayas, Darjeeling and Hong Kong. The larvae feed on Ixora species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achrosis incitata has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

22Amostly conserved

82Cmostly conserved

85Amostly conserved

88Cvariable

92Cmostly conserved

94Tmostly conserved

100Amostly conserved

103Tmostly conserved

118Tmostly conserved

145Tmostly conserved

178Tmostly conserved

181Amostly conserved

197Tvariable

208Tmostly conserved

211Amostly conserved

229Amostly conserved

235Cmostly conserved

287Cmostly conserved

295Cmostly conserved

307Amostly conserved

337Cmostly conserved

343Tmostly conserved

376Cmostly conserved

400Amostly conserved

406Tmostly conserved

407Cmostly conserved

427Tmostly conserved

451Amostly conserved

463Cmostly conserved

508Avariable

514Tmostly conserved

517Amostly conserved

553Amostly conserved

586Amostly conserved

616Tmostly conserved

634Tmostly conserved

637Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCAGAATTAGGTAACCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes10

BINs2

Most divergent pair4.6%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achrosis excitatasame genus4.0%Achrosis innotatasame genus5.2%Scopula acidaliasame family7.6%Tephronia mosessame family7.9%Tephronia sepiariasame family7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type67 records

Wild obs. + sensor59

Museum / vouchered8

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 26≤1 km 18≤10 km 4>10 km 2

50 georeferenced · 9 without coordinates

Open the mapobservation + sensor59

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ZSMlocation not on record	7
Bavarian State Collection of Zoologylocation not on record	1

2 institutions · 8 of 8 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Achrosis incitata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 18.0–18.0

Seasonal swing summer↔winter12.9 °C

Max temp (day)22.0 °C

Min temp (night)12.7 °C

Precipitation127 mm/mo

Air humidity66.0 %

Moisture balance30.1 mm/mo

Vapour deficit695 Pa

Wind speed0.6 m/s

Cloud cover29.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)