Acholla multispinosa

(De Geer, 1773) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Reduviidae/Acholla

At a glance

Occurrence records1 027

Data sources6

Biological traits0

DNA specimens13

eDNA detections11

Sources6 archives

Databases and archives Acholla multispinosa's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 027 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 027 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD13 specimens

01Narrative

Acholla multispinosa is a species of assassin bug in the family Reduviidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acholla multispinosa has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

253Amostly conserved

295Gmostly conserved

298Tmostly conserved

343Cmostly conserved

484Tmostly conserved

487Cmostly conserved

565Amostly conserved

AACTCTATATTTCCTACTAGGTGCTTGATCAGGGGTGGTGGGAACTTCGCTGAGATTAATAATTCGAATTGAACTGGGAACACCAGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.35%

Haplotypes5

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Scipinia horridasame family9.7%Sinea diademasame family10.7%Sinea rileyisame family12.3%Nagusta goedeliisame family12.8%Rhynocoris segmentariussame family13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 027 records

Wild obs. + sensor900

Museum / vouchered127

Range

Area of Occupancy AOO3 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 523≤1 km 103≤10 km 35>10 km 91

752 georeferenced · 148 without coordinates

Open the mapobservation + sensor900

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤1 km 15≤10 km 65

80 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence127

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	81
University of Guelphlocation not on record	28
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
US	1
Vancouver, CA	1
Centre for Biodiversity Genomicslocation not on record	1

6 institutions · 117 of 127 vouchered records shown · 10 without an institution code

09Environmental DNA11 detections

Where the DNA of Acholla multispinosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

ForestBeachfarmWetlandGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 17.6–22.0

Seasonal swing summer↔winter27.7 °C

Max temp (day)24.2 °C 21.3–25.7

Min temp (night)19.9 °C 14.7–19.9

Precipitation94.8 mm/mo 74.5–99.7

Air humidity58.0 % 58.0–59.3

Moisture balance-97.2 mm/mo -97.2–-37.5

Vapour deficit1,086 Pa 834–1,101

Wind speed6.10 m/s 2.70–6.50

Cloud cover39.2 % 37.4–44.4

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acholla multispinosa

At a glance

Sources6 archives

At a glance

Record type1 027 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 027 records