Achillea setacea
Waldst. & Kit. · speciesAt a glance
Occurrence records5 324
Data sources11
Biological traits27
DNA specimens17
eDNA detections1 745
Sources11 archives
Databases and archives Achillea setacea's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 324 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI1 745 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics17 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources27 traits
Chemical compositionLOTUS100 compounds
Occurrence & distributionGBIF5 324 records
Environmental DNA4 datasets · 17 countries1 745 detections
DNA & barcodingBOLD · NCBI17 specimens
Genome at a glanceCCDB · GoaT2.5 Gbp
01Narrative
Il millefoglio setaceo è una specie di pianta angiosperma dicotiledone della famiglia delle Asteraceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology4
Plant height0.225 m
Plant height max0.7 m
Plant height min0.1 m
Seed mass0.074 mg
⚠ sources differ — TRY: 0.074 mg · LEDA: 0.17 mg · GIFT: 0.17 mg
Life cycle & reproduction10
Deciduousnessdeciduous
Dispersal typeself
⚠ sources differ — LEDA: boleochor · GIFT: anemochorous
Flowering endAug
Flowering startJun
Life formperennial
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Self fertilizationabsent
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 400 m
Elevation mean1 470 m
Elevation min540 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTcropfields,forest,forestedges,meadows,oldfields,parks
Woodinessnon-woody
Physiology & chemistry2
Photosynthetic pathwayC3
Seed longevity index0.5
03Chemical composition100 compounds
Compounds documented for Achillea setacea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Guaiane sesquiterpenoids35
Flavones15
Germacrane sesquiterpenoids14
Flavonols11
Bisabolane sesquiterpenoids9
Documented compounds100 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Caryophyllene | present | LOTUS | |
| (1R,2S,3S,6R,7S,10R,11S)-1,6,10-trimethyl-4,14-dioxatetracyclo[9.2.1.02,10.03,7]tetradecan-5-one | present | LOTUS | |
| (1R,4S,5S)-2-methyl-5-[(2R)-6-methylhept-5-en-2-yl]cyclohex-2-ene-1,4-diol | present | LOTUS | |
| (1S,2R,4S,5R,9S,10S,11R,13S,14R)-2,4-dihydroxy-2,11-dimethyl-6-methylidene-8,12,15-trioxapentacyclo[8.5.0.01,14.05,9.011,13]pentadecan-7-one | present | LOTUS | |
| (1S,2S,4R,7E,11S,12R)-4,8,12-trimethyl-3,14-dioxatricyclo[9.3.0.02,4]tetradec-7-en-13-one | present | LOTUS | |
| (2s,4r)-4-Hydroxy-1,1-Dimethylpyrrolidinium-2-Carboxylate | present | LOTUS | |
| (3R,3As,5aR,6R,9aS,9bS)-6-hydroxy-3,5a-dimethyl-9-methylidene-3a,4,5,6,7,8,9a,9b-octahydro-3H-benzo[g][1]benzofuran-2-one | present | LOTUS | |
| (3R,3aS,5aR,6R,9bS)-6-hydroxy-3,5a,9-trimethyl-3,3a,4,5,6,7,8,9b-octahydrobenzo[g][1]benzofuran-2-one | present | LOTUS | |
| (3R,3aS,5aR,6R,9R,9aS,9bS)-6,9-dihydroxy-3,5a,9-trimethyl-3a,4,5,6,7,8,9a,9b-octahydro-3H-benzo[g][1]benzofuran-2-one | present | LOTUS | |
| (3R,3aS,6Z,9S,10E,11aR)-9-hydroxy-3,6,10-trimethyl-3a,4,5,8,9,11a-hexahydro-3H-cyclodeca[b]furan-2-one | present | LOTUS |
05DNA & barcoding17 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achillea setacea has left across the world's sequence archives.
At a glance
DNA specimens17
Marker genes5
GenBank sequences10
eDNA detections1 745
Countries17
The DNA barcodea real sequence read deposited for this species
TTTTTTGGACCTGGTAAATGTGTCATTGACGCAATAACAACCCCCGGCACAATGTGTGCCAAGGAAAACTAAACTTGAGAAGGCTTGTTT …
Achillea setacea voucher KS23 HER0610 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL4★rbcLa★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Achillea setacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 489 010 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Achillea setacea2.49 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy2× diploid · measured
Chromosome records18–722n range36median36mode55records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3635×CCDB · slov-fl · CCDB · fl-europaea · CCDB · poland +6
CCDB · slov-fl — Háberová I., 1963: Problémy stanovenia polyploidného komplexu Achillea millefolium L. s. l. na Východoslovenskej nížine. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 10: 321-350.
CCDB · slov-fl — Danihelka J. & Rotreklová O., 2001: Chromosome numbers within the Achillea millefolium and the A. distans groups in the Czech Republic and Slovakia. - Folia Geobotanica 36/2: 163-191.
CCDB · fl-europaea — Polya, 1948
CCDB · poland — O?wiecimska M. 1966. Zmienno?? zawarto?ci olejku lotnego i azulenw w zielu krwawnika. Cz. V. Korelacja mi?dzy ploidalno?ci? i obecno?ci? prochamazulenu. Diss. Pharmaceut. et Pharmacol. 18, 199-209.
CCDB · poland — O?wiecimska M. and Gaw?owska M. 1967. Pomocnicze metody oznaczania taksonw zbiorowego gatunku Achillea millefolium L. s.l. Cz. I. Korelacja mi?dzy ploidalno?ci?, wielko?ci? ziarn py?ku i chemizmem ro?liny. Herba Pol. 13, 3-11.
CCDB · poland — D?browska J. 1971. Korelacja mi?dzy liczb? chloroplastw w komrkach szparkowych a poziomem poliploidalno?ci czternastu taksonw Achillea L. Herba Pol. 17, 200-208.
CCDB · ipcn-api-dl — Mededovi;aac, S. 1984. Citogenetic variability and possible directions of kariotype evolution in the genus Achillea on the Dinarids. God. Biol. Inst. Univ. Sarajevo. 37: 61–78.
CCDB · ipcn-api-dl — Magulaev, A. Y. 1982. The number of chromosomes of the species of Asteraceae, Caryophyllaceae and Plantaginaceae of the North Caucasus. Biol. Nauki (Moscow) 11 (227): 74–79.
CCDB · ipcn-api-dl — Androshchuk, A. F. I. L. D. K. 1981. Chromosome numbers of the genus Achillea L. Certain species cultivated in botanical gardens. Ukrajins'k. Bot. Žurn. 38 (2): 53–57.
CCDB · ipcn-api-dl — Kuzmanov, B. A., M. A. Zdravkova & S. B. Georgieva. 1989. Variability of the Bulgarian yarrow species from the group Achillea millefolium and A. crithmifolia. 1. Morphological and karyological study. Fitologija 36: 26–43.
CCDB · ipcn-api-dl — Androshchuk, A. F. 1984. Pp. 101--105 in K. M. Sytnika (editor), Tysiachelistniki.
CCDB · ipcn-api-dl — Dabrowska, J. 1992. Chromosome number and DNA content in taxa of Achillea L. in relation to the distribution of the genus. Prace Bot. Univ. Wroclawsk. 49: 1–83.
CCDB · ipcn-api-dl — Vetter, S. 1995. Kreuzungsexperimente mit tetraploiden Sippen der Achillea millefolium--Gruppe (Asteraceae): Sesquiterpene und morphologische Merkmale hybridogener F1 Populationen im vergleich. Linzer Biol. Beitr. 27: 1161–1211.
CCDB · ipcn-api-dl — Rehberger, U. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — OSWIECIMSKA, M. 1968. Achillea collina Becker---Ein proazulenhaltiges Taxon von Achillea millefolium L. s.1. Pl. Med. (Stuttgart) 16: 201–207.
CCDB · ipcn-api-dl — OSWIECIMSKA, M. 1974. Korrelation zwischen Chromosomenzahl und Prochamazulenea in Achillea von Osteuropa. Pl. Med. (Stuttgart) 25: 389–395.
CCDB · ipcn-api-dl — PLCHOVA, S., V. SPURNA & Z. KARPFEL. 1970. Intra- and interspecific differentiation within the Achillea genus. Pl. Med. (Stuttgart) 19: 75–82.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 2000. Karyology of the flora of Byelarus. Page 42 in Thesis of the Diss. Doc. Biol. Sci. Minsk.
CCDB · ipcn-api-dl — Shalabi, A. & G. Verzar-petri. 1979. Cytological conditions and composition of essential oil T of the Hungarian Millefolii Herba. Pl. Med. 36:291.
CCDB · ipcn-api-dl — Baltisberger. 2006. Cytological investigations on Bulgarian phanerogams. Willdenowia 36(Special Issue): 205–216.
CCDB · ipcn-api-dl — Lippert. 2006. Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten. Ber. Bayer. Bot. Ges. 76: 85–110.
CCDB · book-ipcn67-71 — KUZMANOV, B.A., & S.I. KOZUHAROV. 1970. In IOPB chromosome number reports XXVI. Taxon 19: 264-269.
CCDB · book-ipcn73-74 — DERSCH, G. 1974. Ueber einige Chromosomenzahlungen an mitteleuropaischen Blutenpflanzen. II. Philippia 2: 75-82.
CCDB · book-fedorov — P6lya 1948
CCDB · book-fedorov — Ehrendorfer 1952, 1953b, 1959b, 1962c m
CCDB · book-fedorov — Schneider I. 1958
CCDB · book-atlas-flowering-plants — Europe
CCDB · kew — Dabrowska J. 1992. Chromosome number and DNA content in taxa of Achillea L. in relation to the distribution of the genus. Prace Botaniczne 49: 1-84.
2n 1814×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · poland +4
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · poland — O?wiecimska M. 1966. Zmienno?? zawarto?ci olejku lotnego i azulenw w zielu krwawnika. Cz. V. Korelacja mi?dzy ploidalno?ci? i obecno?ci? prochamazulenu. Diss. Pharmaceut. et Pharmacol. 18, 199-209.
CCDB · poland — O?wiecimska M. and Gaw?owska M. 1967. Pomocnicze metody oznaczania taksonw zbiorowego gatunku Achillea millefolium L. s.l. Cz. I. Korelacja mi?dzy ploidalno?ci?, wielko?ci? ziarn py?ku i chemizmem ro?liny. Herba Pol. 13, 3-11.
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · ipcn-api-dl — Kuzmanov, B. A., M. A. Zdravkova & S. B. Georgieva. 1989. Variability of the Bulgarian yarrow species from the group Achillea millefolium and A. crithmifolia. 1. Morphological and karyological study. Fitologija 36: 26–43.
CCDB · ipcn-api-dl — Khaniki, G. B. 1995. Chromosome numbers and morphometry in Achillea (Anthemideae, Compositae). Nucleus (Calcutta) 38(3): 104–111.
CCDB · ipcn-api-dl — Tohidast-Akrad, M. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Danihelka, J. & O. Rotreklová. 2001. Chromosome numbers within the Achillea millefolium and the A. distans groups in the Czech Republic and Slovakia. Folia Geobot. 36: 163–191.
CCDB · book-ipcn67-71 — CONTANDRIOPOULOS, J.' & D. MARTIN. 1967. Contribution a l'etude cytotaxinomique des Achillea de Grece. Irregularites de la meiose. Bull. Bot. Soc. France 114: 257-275.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Cytotaxonomic investigations in some angiosperms collected in the Valley of Aosta and in the National Park "Gran Paradiso". Carylogia 23: 363-379.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · kew — Dabrowska J. 1992. Chromosome number and DNA content in taxa of Achillea L. in relation to the distribution of the genus. Prace Botaniczne 49: 1-84.
CCDB · Cave1959 — Ehrendorfer 1959a
2n 454×CCDB · ita-fl · CCDB · slov-fl · CCDB · ipcn-api-dl
CCDB · ita-fl — MAFFEI M., DEIRINI L., CODIGNOLA A. - 1987 (1986). Numeri cromosomici per la flora italiana: 1064-1069.. Inform. Bot. Ital. , 18(1-2-3): 153-158.
CCDB · slov-fl — Háberová I., 1963: Problémy stanovenia polyploidného komplexu Achillea millefolium L. s. l. na Východoslovenskej nížine. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 10: 321-350.
CCDB · ipcn-api-dl — Maffei, M., L. Deirino & A. Codignola. 1986. Numeri cromosomici per la flora Italiana: 1064--1069. Inform. Bot. Ital. 18: 153–158.
CCDB · ipcn-api-dl — Danihelka, J. & O. Rotreklová. 2001. Chromosome numbers within the Achillea millefolium and the A. distans groups in the Czech Republic and Slovakia. Folia Geobot. 36: 163–191.
2n 323×CCDB · book-fedorov · CCDB · Cave1963
CCDB · book-fedorov — Haberova 1963
CCDB · book-fedorov — I. 1963)
CCDB · Cave1963 — m{berova" 1963
2n 723×CCDB · ita-fl · CCDB · iber-fl · CCDB · book-ipcn67-71
CCDB · ita-fl — D'OVIDIO R. - 1987 (1986). Numeri cromosomici per la flora italiana: 1082-1093.. Inform. Bot. Ital. , 18(1-2-3): 168-175.
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. II. Compositae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 299-314(1973).
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
2n 431×CCDB · Austria_checklist
CCDB · Austria_checklist — -- 1953. Systematische und zytogenetische Untersuchungen an europ?ischen Rassen des Achillea-millefolium-Komplexes. ?sterr.Bot.Z. 100, 583-592., Schneider, I. 1957. Zytogenetische Untersuchungen an Sippen des Polyploid-Komplexes Achillea millefolium L. s.
n 92×CCDB · book-ipcn67-71 · CCDB · Cave1959
CCDB · book-ipcn67-71 — CONTANDRIOPOULOS, J.' & D. MARTIN. 1967. Contribution a l'etude cytotaxinomique des Achillea de Grece. Irregularites de la meiose. Bull. Bot. Soc. France 114: 257-275.
CCDB · Cave1959 — Ehrendorfer 1959a
n 182×CCDB · ipcn-api-dl · CCDB · Cave1959
CCDB · ipcn-api-dl — Rehberger, U. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · Cave1959 — Ehrendorfer 1959b
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type5 324 records
Wild obs. + sensor3 625
Museum / vouchered1 545
Other154
Range
Area of Occupancy AOO11 472 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy64% within 1 km
≤100 m 1 212≤1 km 581≤10 km 928>10 km 93
2 814 georeferenced · 811 without coordinates
Open the mapobservation + sensor3 625
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy67% within 1 km
≤100 m 293≤1 km 192≤10 km 199>10 km 43
727 georeferenced · 818 without coordinates
Open the institutions mapphysical evidence1 545
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions28 of 65 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 218 |
| BRNUlocation not on record | 186 |
| Zürich, CH | 80 |
| Zürich, CH | 73 |
| Uniwersytet Wrocławskilocation not on record | 61 |
| BIO-UNIPIlocation not on record | 53 |
| LDlocation not on record | 43 |
| Berlin, DE | 42 |
| Urumqi, CN | 34 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 32 |
| Yangling, CN | 30 |
| WNNUlocation not on record | 21 |
| KFGBlocation not on record | 20 |
| Bern, CH | 19 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 16 |
| GJOlocation not on record | 16 |
| Wlocation not on record | 13 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 9 |
| PRClocation not on record | 8 |
| Oskarshamn, SE | 7 |
| Beijing, CN | 7 |
| Dresden, DE | 7 |
| Salzburg, AT | 6 |
| Görlitz, DE | 5 |
| Frankfurt am Main | 5 |
| BFLlocation not on record | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Barcelona, ES | 4 |
| CZE050location not on record | 4 |
| CJBGlocation not on record | 4 |
| Sion, CH | 4 |
| Urumqi, CN | 4 |
| València, ES | 4 |
| Paris, FR | 4 |
| BG-NMNHSlocation not on record | 3 |
| Provincia di Livornolocation not on record | 3 |
| MeiseBGlocation not on record | 3 |
| Salamanca, ES | 3 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 3 |
| Shanghai, CN | 3 |
| MAlocation not on record | 2 |
| GZUlocation not on record | 2 |
| Edinburgh, GB | 2 |
| Servico de Microbiologia e Imunologialocation not on record | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Mlocation not on record | 2 |
| Guangzhou, CN | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| BClocation not on record | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| SZUlocation not on record | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Taipei, TW | 1 |
| Beijing, CN | 1 |
| Chapel Hill, US | 1 |
| Wuhan, CN | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Bourges, FR | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Bloomington, US | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Turpan Eremophytes Botanical Garden, Herbariumlocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Uppsala, SE | 1 |
| Palacký University in Olomouclocation not on record | 1 |
65 institutions · 1 102 of 1 545 vouchered records shown · 436 without an institution code
09Environmental DNA1 745 detections
Where the DNA of Achillea setacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found1 745
Studies independent surveys4
Countries17
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 1 745 detections have coordinates
Open the map17 countries0
Piedmont desertForest belt
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.1 °C 7.60–16.8
Seasonal swing summer↔winter21.4 °C
Max temp (day)13.5 °C 10.6–20.8
Min temp (night)7.60 °C 5.20–13.0
Precipitation82.3 mm/mo 56.6–95.3
Air humidity61.9 % 59.7–65.0
Moisture balance-5.90 mm/mo -41.4–15.6
Vapour deficit492 Pa 367–761
Wind speed4.00 m/s 2.60–5.70
Cloud cover49.5 % 37.5–63.6
CHELSA 1981–2010, ~9 km grid, at location & month of 1 740 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.