Achillea ochroleuca

Ehrh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Achillea

At a glance

Occurrence records271

Data sources10

Biological traits10

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Achillea ochroleuca's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility271 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS22 compounds

Occurrence & distributionGBIF271 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

{{#ifeq:0|0|{{#if:|{{#if:Achilleaochroleuca|[}}|}}}} Дереві́й блі́до-жо́втий — багаторічна рослина родини айстрових, поширена в Європі.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height max0.6 m

Plant height min0.1 m

Seed mass0.051 mg

Life cycle & reproduction3

Flowering endAug

Flowering startJun

Life spanperennial

Habitat & environment4

Climatetemperate

Growth formherb

Habitat GIFTsand, stony places

Woodinessnon-woody

03Chemical composition22 compounds

Compounds documented for Achillea ochroleuca across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Simple coumarins4

Dihydroflavonols4

Cycloeudesmane sesquiterpenoids $ Eudesmane sesquiterpenoids3

Flavanones3

Farnesane sesquiterpenoids $ Simple coumarins2

Documented compounds22 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R)-3,5,7-trihydroxy-2-(4-hydroxy-3-methoxyphenyl)-8-(3-methylbut-2-enyl)-2,3-dihydrochromen-4-one	present	NPASS
(2R,3R)-3,5,7-trihydroxy-6-(3-methylbut-2-enyl)-2-phenyl-2,3-dihydrochromen-4-one	present	NPASS
(2R,3R)-3,5-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-7-methoxy-8-(3-methylbut-2-enyl)-2,3-dihydrochromen-4-one	present	NPASS
(2S)-2-(3,4-dihydroxyphenyl)-5-hydroxy-7-methoxy-8-(3-methylbut-2-enyl)-2,3-dihydrochromen-4-one	present	NPASS
(2S)-5,7-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-8-(3-methylbut-2-enyl)-2,3-dihydrochromen-4-one	present	NPASS
(3aR,4aR,5R,8aR,9aR)-5-hydroxy-5,8a-dimethyl-3-methylidene-3a,4,4a,6,7,8,9,9a-octahydrobenzo[f][1]benzofuran-2-one	present	NPASS
(3aR,4aS,5S,8aS,9aR)-5-hydroxy-5,8a-dimethyl-3-methylidene-3a,4,4a,6,7,8,9,9a-octahydrobenzo[f][1]benzofuran-2-one	present	NPASS
(3aS,4aR,5R,8aR,9aS)-5-hydroxy-5,8a-dimethyl-3-methylidene-3a,4,4a,6,7,8,9,9a-octahydrobenzo[f][1]benzofuran-2-one	present	NPASS
1-(7-Methoxy-2,2-dimethyl-2H-1-benzopyran-6-yl)ethanone	present	NPASS
1-[(2S)-6-methoxy-2-prop-1-en-2-yl-2,3-dihydro-1-benzofuran-5-yl]ethanone	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achillea ochroleuca has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAY603224.1 ↗623 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGCGAACACGTAAAAACAACCAAGCGTGAGTGGTTTAAGCAATTGTTTGATCCTCTCGATGCTTA …

Achillea ochroleuca internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Achillea ochroleuca carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 189×CCDB · slov-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +2

CCDB · slov-fl — Uhríková A. & Májovský J., 1980: [Report], pp. 725-726. - In: Löve Á. (ed.), Chromosome number reports LXIX, Taxon 29 /5-6.

CCDB · slov-fl — Uhríková A. & Májovský J., 1978: [Report], pp. 378-379. - In: Löve Á. (ed.), IOPB Chromosome Number Reports LXI, Taxon 27 /4.

CCDB · fl-europaea — Baksay, 1958

CCDB · ipcn-api-dl — Dabrowska, J. 1992. Chromosome number and DNA content in taxa of Achillea L. in relation to the distribution of the genus. Prace Bot. Univ. Wroclawsk. 49: 1–83.

CCDB · ipcn-api-dl — Uhrikova, A. & J. Majovsky. 1980. In Chromosome number reports LXIX. Taxon 29: 725–726.

CCDB · ipcn-api-dl — Van Loon, J. C. & H. C. M. Snelders. 1979. In IOPB chromosome number reports LXV. Taxon 28: 632–634.

CCDB · ipcn-api-dl — Uhrikova, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.

CCDB · book-fedorov — Baksay 1958

CCDB · kew — Dabrowska J. 1992. Chromosome number and DNA content in taxa of Achillea L. in relation to the distribution of the genus. Prace Botaniczne 49: 1-84.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type271 records

Wild obs. + sensor189

Museum / vouchered74

Other8

Origin

Introduced4

Range

Area of Occupancy AOO580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 65≤1 km 50≤10 km 2>10 km 3

120 georeferenced · 69 without coordinates

Open the mapobservation + sensor189

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 4≤1 km 30≤10 km 27

61 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence74

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BRNUlocation not on record	53
Moscow State Universitylocation not on record	5
Görlitz, DE	3
Wlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
inatura Erlebnis Naturschau GmbHlocation not on record	1
Uppsala, SE	1
BG-NMNHSlocation not on record	1

8 institutions · 68 of 74 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Achillea ochroleuca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)