Achillea millefolium
speciesAt a glance
Occurrence records1 458 186
Data sources16
Biological traits154
DNA specimens189
eDNA detections97
Sources16 archives
Databases and archives Achillea millefolium's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 458 186 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI97 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics189 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources154 traits
Chemical compositionLOTUS · NPASS337 compounds
Occurrence & distributionGBIF1 458 186 records
Environmental DNA1 datasets · 13 countries97 detections
DNA & barcodingBOLD · NCBI189 specimens
Genome at a glanceCCDB · GIFT · GoaT7.3 Gbp
01Narrative
L'Achillée millefeuille ou la Millefeuille est une espèce de plantes herbacées vivaces de la famille des Astéracées, cosmopolite dans l'hémisphère Nord. C'est une plante comestible dont on peut utiliser les feuilles et l'une des plantes le plus couramment utilisées en médecine traditionnelle depuis plus de 3 000 ans.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology24
Fruit length3 mm
⚠ sources differ — AusTraits: 3 mm · GIFT: 2 mm
Fruit length max2 mm
Fruit length min2 mm
Leaf length20 mm
⚠ sources differ — AusTraits: 20 mm · GIFT: 60 mm
Leaf length max150 mm
Leaf length min20 mm
Leaf mass21.3 mg
Leaf size178 mm²
⚠ sources differ — TRY: 178 mm² · LEDA: 411 mm² · GIFT: 411 mm²
Leaf width16.5 mm
⚠ sources differ — AusTraits: 16.5 mm · GIFT: 15 mm
Leaf width max25 mm
Leaf width min5 mm
Plant height0.654 m
⚠ sources differ — GIFT: 0.654 m · AusTraits: 0.6 m · LEDA: 0.395 m · USDA: 0.914 m · TRY: 0.149 m
Plant height generative0.483 m
Plant height max1.2 m
Plant height min0.05 m
Seed length1.86 mm
⚠ sources differ — TRY: 1.86 mm · GIFT: 2.1 mm
Seed length max2.1 mm
Seed length min2.1 mm
Seed mass0.137 mg
⚠ sources differ — TRY: 0.137 mg · LEDA: 0.137 mg · GIFT: 0.179 mg
Seed mass max1.1 mg
Seed mass min0.05 mg
Seed volume0.545 mm³
Seed volume max0.77 mm³
Seed volume min0.32 mm³
Life cycle & reproduction38
After harvest regrowth rateModerate
Bloom periodEarly Summer
Coppice potentialNo
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flower colourwhite
Flower conspicuousYes
Flowering endAug
Flowering startJul
Flowering timeyyyynnnnnnyy
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryModerate
Lifespan years2.5 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number2 400
Seed spread rateSlow
Seedling vigorLow
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateSlow
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment35
Active growth periodSpring
Adapted to coarse textured soilsNo
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatLow
Climatetemperate
Climberself-supporting
Elevation max3 500 m
Elevation mean2 400 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Growth form USDARhizomatous
Habitat GIFTforest, meadows, sand, stony places
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf formlinear-lanceolate
Leaf retentionNo
Leaf shapenarrowly_elliptical oblanceolate
Low growing grassNo
Mycorrhizaabsent
Mycorrhiza typearbuscular
Root depth min8 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry29
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min120 days
Leaf C:N ratio20.07 g/g
Leaf c435 mg/g
Leaf dry-matter content (LDMC)241 mg/g
⚠ sources differ — TRY: 241 mg/g · LEDA: 186 mg/g
Leaf n24.84 mg/g
Leaf p2.42 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min8 in
Protein potentialLow
Salinity toleranceLow
Seed longevity index0
Shade toleranceMedium
Soil pH max8 pH
Soil pH min6 pH
Specific leaf area (SLA)16.18 mm²/mg
⚠ sources differ — TRY: 16.18 mm²/mg · LEDA: 19.48 mm²/mg · GIFT: 18.93 mm²/mg
Temperature min-38 °F
Wood density55.22 mg/cm³
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalMedium
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound2 852 012 per lb
ToxicitySlight
Veneer productNo
Other traits11
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceYes
Leaf marginentire
Leaf spinesno
Leaf thornsno
Planting density max19 000 per acre
Planting density min4 800 per acre
Seeds per fruit>1000
03Chemical composition337 compounds
Compounds documented for Achillea millefolium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Iridoids monoterpenoids30
Guaiane sesquiterpenoids25
Flavones17
N-acyl amines16
Germacrane sesquiterpenoids16
Documented compounds337 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-1(10),4-Cadinadiene | present | LOTUS | |
| (+)-3-Thujone | present | LOTUS | |
| (+)-alpha-Pinene | present | LOTUS | |
| (+)-alpha-Thujone | present | LOTUS | |
| (+)-beta-Caryophyllene | present | LOTUS | |
| (+)-Borneol acetate | present | NPASS | |
| (+)-Isoborneol | present | LOTUS | |
| (+)-Valine | present | LOTUS | |
| (-)-3-Isothujone | present | LOTUS | |
| (-)-beta-Pinene | present | LOTUS |
05DNA & barcoding189 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achillea millefolium has left across the world's sequence archives.
At a glance
DNA specimens189
Marker genes10
GenBank sequences10
eDNA detections97
Countries17
The DNA barcodea real sequence read deposited for this species
TGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCA …
Achillea millefolium isolate LLV1 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★trnL-F★ITS5★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Achillea millefolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size7 295 880 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Achillea millefolium7.3 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 54 n = 27
Ploidy6× hexaploid · measured
Chromosome records18–1162n range54median54mode277records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 54152×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +20
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — MARCHI P., CAPINERI R., D'AMATO G. - 1974. Numeri cromosomici per la flora italiana:182-189.. Inform. Bot. Ital. , 6(3): 303-312.
CCDB · slov-fl — Háberová I., 1963: Problémy stanovenia polyploidného komplexu Achillea millefolium L. s. l. na Východoslovenskej nížine. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 10: 321-350.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Danihelka J. & Rotreklová O., 2001: Chromosome numbers within the Achillea millefolium and the A. distans groups in the Czech Republic and Slovakia. - Folia Geobotanica 36/2: 163-191.
CCDB · slov-fl — Skalińska M. et al., 1964: Additions to chromosome numbers of Polish Angiosperms (Fifth contribution). - Acta Soc. Bot. Poloniae 33/1: 45-76.
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · brit-fl — Briggs, D. (1964)
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4053
CCDB · fl-europaea — Gadella & Kliphuis
CCDB · fl-europaea — Majovsky et al.,
CCDB · poland — D?browska J. 1971. Korelacja mi?dzy liczb? chloroplastw w komrkach szparkowych a poziomem poliploidalno?ci czternastu taksonw Achillea L. Herba Pol. 17, 200-208.
CCDB · poland — Mizianty M. and Frey L. 1973. Chromosome number of some vascular plants in the Western Bieszczady Mts (south-eastern Poland). Fragm. Flor. Geobot. 19, 265-270.
CCDB · poland — O?wiecimska M. and Gaw?owska M. 1967. Pomocnicze metody oznaczania taksonw zbiorowego gatunku Achillea millefolium L. s.l. Cz. I. Korelacja mi?dzy ploidalno?ci?, wielko?ci? ziarn py?ku i chemizmem ro?liny. Herba Pol. 13, 3-11.
CCDB · poland — O?wiecimska M. 1966. Zmienno?? zawarto?ci olejku lotnego i azulenw w zielu krwawnika. Cz. V. Korelacja mi?dzy ploidalno?ci? i obecno?ci? prochamazulenu. Diss. Pharmaceut. et Pharmacol. 18, 199-209.
CCDB · poland — D?browska J. 1977. Obserwacje kariologiczne szesnastu taksonw Achillea L. wyst?puj?cych w Polsce i na obszarach s?siednich. Herba Pol. 23, 225-233.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.
CCDB · ipcn-api-dl — Mizianty, M. & L. Frey. 1973. Chromosome numbers of some vascular plants in the Western Bieszczady Mts. (South-eastern Poland). Fragm. Florist. Geobot. 19: 265–270.
CCDB · ipcn-api-dl — Kuzmanov, B. A., M. A. Zdravkova & S. B. Georgieva. 1989. Variability of the Bulgarian yarrow species from the group Achillea millefolium and A. crithmifolia. 1. Morphological and karyological study. Fitologija 36: 26–43.
CCDB · ipcn-api-dl — Androshchuk, A. F. 1984. Pp. 101--105 in K. M. Sytnika (editor), Tysiachelistniki.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Huber, W. & M. Baltisberger. 1992. IOPB chromosome data 4. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 18/19: 6–8.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.
CCDB · ipcn-api-dl — Pireh, W. & R. J. Tyrl. 1980. Cytogeography of Achillea millefolium in Oklahoma and adjacent States. Rhodora 80: 361–367.
CCDB · ipcn-api-dl — Danihelka, J. & O. Rotreklová. 2001. Chromosome numbers within the Achillea millefolium and the A. distans groups in the Czech Republic and Slovakia. Folia Geobot. 36: 163–191.
CCDB · ipcn-api-dl — Marchi, P., R. Capineri & G. D'AMATO. 1974. Numeri cromosomici per la flora Italiana: 182-189. Inform. Bot. Ital. 6: 303–312.
CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.
CCDB · ipcn-api-dl — Lippert. 2006. Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten. Ber. Bayer. Bot. Ges. 76: 85–110.
CCDB · ipcn-api-dl — Dabrowska, J. 1992. Chromosome number and DNA content in taxa of Achillea L. in relation to the distribution of the genus. Prace Bot. Univ. Wroclawsk. 49: 1–83.
CCDB · ipcn-api-dl — Androshchuk, A. F. I. L. D. K. 1981. Chromosome numbers of the genus Achillea L. Certain species cultivated in botanical gardens. Ukrajins'k. Bot. Žurn. 38 (2): 53–57.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — OSWIECIMSKA, M. 1968. Achillea collina Becker---Ein proazulenhaltiges Taxon von Achillea millefolium L. s.1. Pl. Med. (Stuttgart) 16: 201–207.
CCDB · ipcn-api-dl — Dabrowska, J. 1989. The chromosome numbers of several taxa of the genus Achillea L. Acta Soc. Bot. Poloniae 58: 163–177.
+90 more references
2n 3677×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · ipcn-api-dl +12
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Danihelka J. & Rotreklová O., 2001: Chromosome numbers within the Achillea millefolium and the A. distans groups in the Czech Republic and Slovakia. - Folia Geobotanica 36/2: 163-191.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Dabrowska, J. 1992. Chromosome number and DNA content in taxa of Achillea L. in relation to the distribution of the genus. Prace Bot. Univ. Wroclawsk. 49: 1–83.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1980b. In Chromosome number reports LXIX. Taxon 29: 707–709.
CCDB · ipcn-api-dl — Mededovi;aac, S. 1984. Citogenetic variability and possible directions of kariotype evolution in the genus Achillea on the Dinarids. God. Biol. Inst. Univ. Sarajevo. 37: 61–78.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1987. Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23–33.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1990. Chromosome numbers in some species of flowering plants of the Urals (the Komi Autonomous Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 75: 1622–1624.
CCDB · ipcn-api-dl — Krasnikov, A. A. & M. N. Lomonosova. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. I. Bot. Žhurn. (Moscow & Leningrad) 75: 116–118.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1991. Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 76: 473–476.
CCDB · ipcn-api-dl — Vetter, S. 1995. Kreuzungsexperimente mit tetraploiden Sippen der Achillea millefolium--Gruppe (Asteraceae): Sesquiterpene und morphologische Merkmale hybridogener F1 Populationen im vergleich. Linzer Biol. Beitr. 27: 1161–1211.
CCDB · ipcn-api-dl — Vetter, S., M. Lambrou, C. Franz & F. Ehrendorfer. 1996. Cytogenetics of experimental hybrids within the Achillea millefolium polyploid complex (yarrow). Caryologia 49: 1–12.
CCDB · ipcn-api-dl — Meierott, L. 2002. Vorläufige Bemerkungen zu Achillea pratensis Saukel & Länger in Franken. Ber. Bayer. Bot. Ges. 72: 125–128.
CCDB · ipcn-api-dl — Danihelka, J. & O. Rotreklová. 2001. Achillea pratensis---a recently recognized species of the Czech flora. Preslia 73: 1–27.
CCDB · ipcn-api-dl — Lippert. 2006. Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten. Ber. Bayer. Bot. Ges. 76: 85–110.
CCDB · book-ipcn67-71 — SUDA, Y. 1969. In IOPB chromosome number reports xx. Taxon 18: 213-221:-
CCDB · book-ipcn73-74 — PACKER, J. G., & G.D. MCPHERSON. 1974. Chromosome numbers in some vascular plants from northern Alaska. Canad. J. Bot. 52: 1095-1099.
CCDB · book-indian_vol1 — P6lya, L. 1948 ; Ferris, R.S. 1958 ; Huziwara, Y. 1962d ; Faasen, P.V. & Nadeau, P. 1976 ; Tomkins, D.J. & Grant, W.F.-1978 ; Androshchuk, A. F. et al. 1979
CCDB · book-fedorov — Clausen J. et al. 1939, 1940c, 1942
CCDB · book-fedorov — Lawrence 1947
CCDB · book-fedorov — Love A. 1954b
CCDB · book-fedorov — Ehrendorfer 1952, 1959b
CCDB · book-fedorov — Ehrle 1958
CCDB · book-fedorov — Mulligan, Bassett 1959
CCDB · book-fedorov — Turner, Beaman, Rock 1961 pu
CCDB · book-fedorov — Love A., LOve D.
CCDB · book-fedorov — C. n. I. 1964), 1966
CCDB · book-fedorov — Raven 1963b
CCDB · book-fedorov — P6lya 1948
CCDB · book-fedorov — Ferris 1958
CCDB · book-fedorov — Huziwara 1962d
CCDB · book-fedorov — Ehrendorfer 1952
CCDB · book-atlas-flowering-plants — Lawrence 1947
CCDB · kew — Dabrowska J. 1992. Chromosome number and DNA content in taxa of Achillea L. in relation to the distribution of the genus. Prace Botaniczne 49: 1-84.
CCDB · Cave1958 — Ehrle 1958
CCDB · Cave1959 — Mull. & Bass, 1959
CCDB · CromoCat 2015 — Dmitrieva, S. A. & Parfenov, V. I. (1985). Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk (Minsk) 6: 3-8.
CCDB · CromoCat 2015 — Dmitrieva, S. A. (1987). Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23-33.
CCDB · CromoCat 2015 — Efimov (2005). Chromosome numbers of some species of the families Amaryllidaceae, Asteraceae, Fabaceae in North Osetia. Pages 33–35 in Karyology, Karyosystematics and Molecular Phylogeny. St. Petersburg
CCDB · CromoCat 2015 — Efimov, K. F. (1998). Chromosome numbers in some species of the families Asteraceae, Campanulaceae, Fabaceae from central Caucasus. Bot. Žhurn. 83(8): 131–132.
+34 more references
2n 030×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Lundegardh, H. (1909). Uber Reduktionsteilung in der Pollen-Mutterzellen einiger Dicotylen Pflanzen. Svensk Bot. Tidskr. 3: 78-124.
CCDB · CromoCat 2015 — Gervais, C. (1977). Cytological investigation of the Achillea millefolium complex (Compositae) in Quebec. Canad. J. Bot. 55: 796–808.
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
CCDB · CromoCat 2015 — Pireh, W. & R. J. Tyrl. (1980). Cytogeography of Achillea millefolium in Oklahoma and adjacent States. Rhodora 80: 361–367.
CCDB · CromoCat 2015 — Razaq, Z. A., A. A. Vahidy & S. I. Ali. (1994). Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800-808.
CCDB · CromoCat 2015 — Rostovtseva, T. S. (1979). Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Žurn. 64: 582-589.
CCDB · CromoCat 2015 — Gupta, R. C. & Gill, B. S. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXI]. Taxon 30(2): 514.
CCDB · CromoCat 2015 — Rehberger, U. (2000). In C. Dobeš & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna
CCDB · CromoCat 2015 — Morton, J. K. (1981). Chromosome numbers in Compositae from Canada and the USA. Bot. J. Linn. Soc. 82: 357-368.
CCDB · CromoCat 2015 — Gupta, R. C. & Gill, B. S. (1989). Cytopalynology of north and central Indian Compositae J. Cytol. Genet. 24: 96-105.
CCDB · CromoCat 2015 — Keil, D. J. & Pinkava, D. J. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIII]. Taxon 28(1, 2/3): 271-273.
CCDB · CromoCat 2015 — Mulligan, G. A. (1984). Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447-449.
CCDB · CromoCat 2015 — Mulligan, G.A. & W.J.Cody. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XL]. Taxon 22(2/3): 290-291.
CCDB · CromoCat 2015 — Powell, A. M., D. W. Kyhos & P. H. Raven. (1974). Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.
CCDB · CromoCat 2015 — Turner, B. L., W. L. Ellison & R. M. King. (1961). Chromosome numbers in the Compositae. IV. North American species, with phyletic interpretations. Amer. J. Bot. 48: 216-223.
CCDB · CromoCat 2015 — Ghaffari, S. M. (1999). Chromosome studies in the Iranian Asteraceae II Iranian Journal of Botany 8(1): 91-104
CCDB · CromoCat 2015 — Ghaffari. (2006). New or rare chromosome counts of some angiosperm species from Iran II. Iran. J. Bot. 12(1): 81–86.
CCDB · CromoCat 2015 — Uotila, P. & K. Pellinen. (1985). Chromosome numbers in vascular plants from Finland. Acta Bot. Fenn. 130: 1-37.
2n 1827×CCDB · ita-fl · CCDB · slov-fl · CCDB · iapt +9
CCDB · ita-fl — MAFFEI M., DEIRINI L., CODIGNOLA A. - 1987 (1986). Numeri cromosomici per la flora italiana: 1064-1069.. Inform. Bot. Ital. , 18(1-2-3): 153-158.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · book-ipcn65 — Mehra et al. 1965
CCDB · ipcn-api-dl — Daniela, I. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 13–14.
CCDB · ipcn-api-dl — Gadnidze, R. I., T. N. Gviniashvili, I. M. Danelia & M. V. Churadze. 1998. Chromosome numbers of the species of the Georgian flora. Bot. Žhurn. (Moscow & Leningrad) 83(10): 143–147.
CCDB · ipcn-api-dl — Maffei, M., L. Deirino & A. Codignola. 1986. Numeri cromosomici per la flora Italiana: 1064--1069. Inform. Bot. Ital. 18: 153–158.
CCDB · book-indian_vol1 — Felfoldy, L.J. M. 1947a; Harling, G. 1950; Shetty, B.V. 1964; Mehra, P.N. et al. 1965
CCDB · book-fedorov — Felfoldy 1947a
CCDB · book-fedorov — Harling 1950
CCDB · book-fedorov — Shetty 1964
CCDB · book-fedorov — Mehra P. N. et al. 1965
CCDB · book-fedorov — Ehrendorfer 1953b. 1959a; b, 1962c
CCDB · book-atlas-flowering-plants — Felfoldy 1947,
CCDB · book-atlas-flowering-plants — Harling 1950,
CCDB · kew — Dabrowska J. 1992. Chromosome number and DNA content in taxa of Achillea L. in relation to the distribution of the genus. Prace Botaniczne 49: 1-84.
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Moritz, R. S., Lubogoschinsky, P. I. & Sergeyeva, A. S. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:892-894
CCDB · CromoCat 2015 — Ehrendorfer, F. (1973). New chromosome numbers and remarks on the Achillea millefolium polyploid complex in North America. Oesterr. Bot. Z. 122: 133–143.
CCDB · CromoCat 2015 — Harling, G. (1950). Embryological studies in the Compositae. Part. I. Anthemidae-Anthemidinae. Acta Horti Berg. 15: 135-168.
CCDB · CromoCat 2015 — Mehra, P. N. & P. Remanandan. (1974). Cytological investigations on the Indian Compositae. II. Astereae, Heliantheae, Helenieae and Anthemideae. Caryologia 27(3): 255-284.
CCDB · CromoCat 2015 — Mehra, P. N., B. S. Gill, J. K. Mehta & S. S. Sidhu. (1965a). Cytological investigations on the Indian Compositae. I. North Indian taxa. Caryologia 18: 35-68.
CCDB · CromoCat 2015 — Daniela, I. (1997). IOPB Chromosome Data 11 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 26-27: 13-14.
CCDB · CromoCat 2015 — Plchová, S., Spurná, V. & Karpfel, Z. (1970). Intra- and interspecific differentiation within the Achillea genus Planta Med. 18(5): 75-82.
CCDB · iapt — IAPT/IOPB Chromosome Data 19
CCDB · iapt — IAPT/IOPB Chromosome Data 23
CCDB · Automatic manuscript search — D. Kaur and V. Singhal. 2019. "Meiotic abnormalities affect genetic constitution and pollen viability in dicots from Indian cold deserts". BMC Plant Biology 19:n. pag.
GIFT · GIFT (floras)
2n 7216×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +4
CCDB · iber-fl — Achillea roseo-alba Ehrendf., spec. nov., eine hybridogene, di- und tetraploide Sippe des... Ehrendorfer, F.Oesterr. Bot. Z.106: 363-368(1959).
CCDB · ipcn-api-dl — Magulaev, A. Y. 1982. The number of chromosomes of the species of Asteraceae, Caryophyllaceae and Plantaginaceae of the North Caucasus. Biol. Nauki (Moscow) 11 (227): 74–79.
CCDB · ipcn-api-dl — Rehberger, U. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1981. In Chromosome number reports LXXI. Taxon 30: 514.
CCDB · ipcn-api-dl — Vetter, S., M. Lambrou, C. Franz & F. Ehrendorfer. 1996. Cytogenetics of experimental hybrids within the Achillea millefolium polyploid complex (yarrow). Caryologia 49: 1–12.
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dJ spermatophyta de Portugal. 47(Ser. 2l: 299-314. II Compositae, supl. I Bol. Soc. Brot. I
CCDB · book-indian_vol1 — Zaborsky (Fedorov)
CCDB · book-fedorov — Zaborsky (I. Slov. fl. I. 1967)
CCDB · book-fedorov — Ehrendorfer 1959b
CCDB · CromoCat 2015 — Efimov (2005). Chromosome numbers of some species of the families Amaryllidaceae, Asteraceae, Fabaceae in North Osetia. Pages 33–35 in Karyology, Karyosystematics and Molecular Phylogeny. St. Petersburg
CCDB · CromoCat 2015 — Gupta, R. C. & Gill, B. S. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXI]. Taxon 30(2): 514.
CCDB · CromoCat 2015 — Magulaev, A. Y. (1982). The number of chromosomes of the species of Asteraceae, Caryophyllaceae and Plantaginaceae of the North Caucasus Biologicheskie Nauki 11 (227): 74-79
CCDB · CromoCat 2015 — Rehberger, U. (2000). In C. Dobeš & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna
CCDB · CromoCat 2015 — Androshchuk, A. F. I. L. D. Kostinenko. (1981). Chromosome numbers of the genus Achillea L. Certain species cultivated in botanical gardens. Ukrajins'k. Bot. Žurn. 38 (2): 53–57.
GIFT · GIFT (floras)
2n 457×CCDB · poland · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · poland — O?wiecimska M. and Gaw?owska M. 1967. Pomocnicze metody oznaczania taksonw zbiorowego gatunku Achillea millefolium L. s.l. Cz. I. Korelacja mi?dzy ploidalno?ci?, wielko?ci? ziarn py?ku i chemizmem ro?liny. Herba Pol. 13, 3-11.
CCDB · ipcn-api-dl — Danihelka, J. & O. Rotreklová. 2001. Achillea pratensis---a recently recognized species of the Czech flora. Preslia 73: 1–27.
CCDB · book-ipcn67-71 — TYRL, R.J. 1969. Cytogeography of Achillea millefolium in western Oregon. Brittonia 21: 215-223.
CCDB · CromoCat 2015 — Baltisberger, M. (2006). Cytological investigations on Bulgarian phanerogams Willdenowia 36: 205-216
CCDB · CromoCat 2015 — Gervais, C. (1977). Cytological investigation of the Achillea millefolium complex (Compositae) in Quebec. Canad. J. Bot. 55: 796–808.
CCDB · CromoCat 2015 — Lippert, W. & Heubl, G.R. (1988). Chromosomenzahlen von Pflanzen aus Bayern und angrenzeden Gebieten (Teil 1) Ber. Bayer. Bot. Ges. 59: 13-22.
CCDB · CromoCat 2015 — Dabrowska, J. (1992). Chromosome number and DNA content in taxa of Achilea L. in relation to the distribution of the genus. Acta Univ. Wratislav., Prace Botaniczne 49: 1-83.
2n 275×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ita-fl — MAFFEI M., DEIRINI L., CODIGNOLA A. - 1987 (1986). Numeri cromosomici per la flora italiana: 1064-1069.. Inform. Bot. Ital. , 18(1-2-3): 153-158.
CCDB · ipcn-api-dl — Maffei, M., L. Deirino & A. Codignola. 1986. Numeri cromosomici per la flora Italiana: 1064--1069. Inform. Bot. Ital. 18: 153–158.
CCDB · CromoCat 2015 — Mehra, P. N. & P. Remanandan. (1974). Cytological investigations on the Indian Compositae. II. Astereae, Heliantheae, Helenieae and Anthemideae. Caryologia 27(3): 255-284.
CCDB · CromoCat 2015 — Rehberger, U. (2000). In C. Dobeš & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna
CCDB · CromoCat 2015 — Plchová, S., Spurná, V. & Karpfel, Z. (1970). Intra- and interspecific differentiation within the Achillea genus Planta Med. 18(5): 75-82.
2n 634×CCDB · poland · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · poland — O?wiecimska M. and Gaw?owska M. 1967. Pomocnicze metody oznaczania taksonw zbiorowego gatunku Achillea millefolium L. s.l. Cz. I. Korelacja mi?dzy ploidalno?ci?, wielko?ci? ziarn py?ku i chemizmem ro?liny. Herba Pol. 13, 3-11.
CCDB · ipcn-api-dl — Danihelka, J. & O. Rotreklová. 2001. Chromosome numbers within the Achillea millefolium and the A. distans groups in the Czech Republic and Slovakia. Folia Geobot. 36: 163–191.
CCDB · CromoCat 2015 — Lippert, W. & Heubl, G.R. (1988). Chromosomenzahlen von Pflanzen aus Bayern und angrenzeden Gebieten (Teil 1) Ber. Bayer. Bot. Ges. 59: 13-22.
2n 353×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Rehberger, U. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · CromoCat 2015 — Gervais, C. (1977). Cytological investigation of the Achillea millefolium complex (Compositae) in Quebec. Canad. J. Bot. 55: 796–808.
CCDB · CromoCat 2015 — Rehberger, U. (2000). In C. Dobeš & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna
2n 91×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Mehra, P. N. & P. Remanandan. (1974). Cytological investigations on the Indian Compositae. II. Astereae, Heliantheae, Helenieae and Anthemideae. Caryologia 27(3): 255-284.
2n 341×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 441×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gervais, C. (1977). Cytological investigation of the Achillea millefolium complex (Compositae) in Quebec. Canad. J. Bot. 55: 796–808.
2n 581×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 741×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Efimov, K. F. (1998). Chromosome numbers in some species of the families Asteraceae, Campanulaceae, Fabaceae from central Caucasus. Bot. Žhurn. 83(8): 131–132.
2n 1161×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 0106×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Moritz, R. S., Lubogoschinsky, P. I. & Sergeyeva, A. S. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:892-894
CCDB · CromoCat 2015 — Ehrendorfer, F. (1973). New chromosome numbers and remarks on the Achillea millefolium polyploid complex in North America. Oesterr. Bot. Z. 122: 133–143.
CCDB · CromoCat 2015 — Harling, G. (1950). Embryological studies in the Compositae. Part. I. Anthemidae-Anthemidinae. Acta Horti Berg. 15: 135-168.
CCDB · CromoCat 2015 — Mehra, P. N. & P. Remanandan. (1974). Cytological investigations on the Indian Compositae. II. Astereae, Heliantheae, Helenieae and Anthemideae. Caryologia 27(3): 255-284.
CCDB · CromoCat 2015 — Mehra, P. N., B. S. Gill, J. K. Mehta & S. S. Sidhu. (1965a). Cytological investigations on the Indian Compositae. I. North Indian taxa. Caryologia 18: 35-68.
CCDB · CromoCat 2015 — Gervais, C. (1977). Cytological investigation of the Achillea millefolium complex (Compositae) in Quebec. Canad. J. Bot. 55: 796–808.
CCDB · CromoCat 2015 — Dmitrieva, S. A. & Parfenov, V. I. (1985). Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk (Minsk) 6: 3-8.
CCDB · CromoCat 2015 — Dmitrieva, S. A. (1987). Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23-33.
CCDB · CromoCat 2015 — Efimov (2005). Chromosome numbers of some species of the families Amaryllidaceae, Asteraceae, Fabaceae in North Osetia. Pages 33–35 in Karyology, Karyosystematics and Molecular Phylogeny. St. Petersburg
CCDB · CromoCat 2015 — Efimov, K. F. (1998). Chromosome numbers in some species of the families Asteraceae, Campanulaceae, Fabaceae from central Caucasus. Bot. Žhurn. 83(8): 131–132.
CCDB · CromoCat 2015 — Krasnikov, A. A. & Lomonosova, M. N. (1990). Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region.I. Botani?eskij Žurnal (Moscow & Leningrad) 75: 116-118.
CCDB · CromoCat 2015 — Lavrenko, A. N., Serditov, N. P. & Ulle, L. G. (1990). Chromosome numbers in some species of flowering plants of the Urals ( the Komi Autonomus Soviet Socialist Republic). Bot. Žurn. 75: 1622-1624.
CCDB · CromoCat 2015 — Lavrenko, A. N., Serditov, N. P. & Ulle, L. G. (1991). Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR) Bot. Žurn. 76: 473-476.
CCDB · CromoCat 2015 — Lavrenko, A. N., Serditov, N. P. & Ulle, L. G. (1992). Kariologicheskie osobennosti i rasprostranenie predstavitelej semejstva Asteraceae v pechoro-Ilychskom Biosfernom Zapovednike Trudy Komi Naucnogo Tsentra Ur.O. A.N. S.S.S.R. 126: 52-64.
CCDB · CromoCat 2015 — Mededoviaac, S. (1984). Citogenetic variability and possible directions of kariotype evolution in the genus Achillea on the Dinarids. God. Biol. Inst. Univ. Sarajevo 37: 61-78.
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1985). Kariologicheskaja differenciacija u vidov flory Belorussii i ee rol, v formoobrazovanii. Dokl. Akad. Nauk Byelorussk. SSR. (Minsk) 29(6): 544-557.
CCDB · CromoCat 2015 — Pólya, L. (1948). Chromosome numbers of certain alkali plants. Arch. Biol. Hung. 18: 145-148.
CCDB · CromoCat 2015 — Turesson, G. (1938). Chromosome stability in Linnean species. Ann. Roy. Agr. Coll. Sweden 5: 405-416.
CCDB · CromoCat 2015 — Baltisberger, M. (2006). Cytological investigations on Bulgarian phanerogams Willdenowia 36: 205-216
CCDB · CromoCat 2015 — Albers, F. & Pusch, J. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart
CCDB · CromoCat 2015 — Androshchuk, A. F. (1984). In K. M. Sytnika (editor). Pp. 101-105. Tysiachelistniki, Ki
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1973). Chromosome numbers of flowering plants in the Netherlands VI. Proc. Kon. Ned. Akad. Wetensch. Ser. C 76: 303-311.
CCDB · CromoCat 2015 — Hollingsworth, P. M., Gornall, R. J. & Bailey, J. P. (1992). Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134-137.
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — Jörgensen, C. A., Sörensen, T. H. & Westergaard, M. (1958). The flowering plants of Greenland. A taxonomical and cytological survey. K. Dansk Videnskab. Selskab. Biol. Skrift. 9(4): 1-172.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1961a). Chromosome numbers of central and north-west European plant species. Opera Bot. 5: 1-581.
CCDB · CromoCat 2015 — Löve, A. (1954b). Cytotaxonomical evaluation of corresponding taxa. Vegetatio 5-6: 212-224.
CCDB · CromoCat 2015 — Marchi, P., Capineri, R. & D'Amato, G. (1974). Numeri cromosomici per la flora italiana: 182-189. Inf. Bot. Ital. 6: 303-312.
CCDB · CromoCat 2015 — Mizianty, M. & L. Frey. (1973). Chromosome numbers of some vascular plants in the Western Bieszczady Mts. (South-eastern Poland). Fragmenta Floristica et Geobotanica 19: 265-270
CCDB · CromoCat 2015 — Mizianty, M., L. Frey & Z. Mirek. (1981). Contribution to the knowledge on the chromosome numbers of Polish vascular plantas. Fragm. Florist. Geobot. 27: 19-29.
CCDB · CromoCat 2015 — Morton, J. K. (1981). Chromosome numbers in Compositae from Canada and the USA. Bot. J. Linn. Soc. 82: 357-368.
CCDB · CromoCat 2015 — Pashuk, K. T. (1987). Chromosome number in species of subalpine belt of Chernogora (Ukrainian Carpathians). Bot. Žurn. 72(8): 1069-1074.
CCDB · CromoCat 2015 — Pireh, W. & R. J. Tyrl. (1980). Cytogeography of Achillea millefolium in Oklahoma and adjacent States. Rhodora 80: 361–367.
CCDB · CromoCat 2015 — Skalinska, M., M. Piotrowicz, Sokolowska-Kulczyck & col. (1961). Further additions to chromosome numbers of Polish angiosperms Acta. Soc. Bot. Poloniae 30(3-4): 463-389
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
CCDB · CromoCat 2015 — Gupta, R. C. & Gill, B. S. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXI]. Taxon 30(2): 514.
CCDB · CromoCat 2015 — Magulaev, A. Y. (1982). The number of chromosomes of the species of Asteraceae, Caryophyllaceae and Plantaginaceae of the North Caucasus Biologicheskie Nauki 11 (227): 74-79
CCDB · CromoCat 2015 — Rehberger, U. (2000). In C. Dobeš & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna
CCDB · CromoCat 2015 — Ishikawa, M. (1916). A list of the numbers of chromosomes. Bot. Mag., Tokyo 30: 404-448.
CCDB · CromoCat 2015 — Lundegardh, H. (1909). Uber Reduktionsteilung in der Pollen-Mutterzellen einiger Dicotylen Pflanzen. Svensk Bot. Tidskr. 3: 78-124.
+31 more references
n 1823×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +4
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Ward, D. E. 1981. In Chromosome number reports LXXIII. Taxon 30: 844–845.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1980b. In Chromosome number reports LXIX. Taxon 29: 707–709.
CCDB · ipcn-api-dl — Keil, D. J. & D. J. Pinkava. 1976. Chromosome counts and taxonomic notes for Compositae from the United States and Mexico. Amer. J. Bot. 63: 1393–1403.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — FAASEN, P. V. & P. NADEAU. 1976. In IOPB chromosome number reports LI. Taxon 25: 155–164.
CCDB · ipcn-api-dl — Rehberger, U. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · book-ipcn67-71 — JONES, A. 1968. Chromosome numbers in Ipomoea and related genera. J. Heredity 59: 99-102.
CCDB · book-ipcn73-74 — MULLIGAN, G.A., & W.J. CODY. 197 3. In IOPB chromosome number reports! XL. Taxon 22: 258-291.
CCDB · book-ipcn73-74 — POWELL, A.M., D.W. KYHOS, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.
CCDB · Cave1958 — Ferris 1958
CCDB · Cave1959 — Ehrendorfer 1959b
CCDB · Cave1963 — De.Jong & Long. 1963; Raven 1963b
CCDB · CromoCat 2015 — Faasen, P., van & Nadeau, P. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LI]. Taxon 25(1): 156-158.
CCDB · CromoCat 2015 — Gervais, C. (1977). Cytological investigation of the Achillea millefolium complex (Compositae) in Quebec. Canad. J. Bot. 55: 796–808.
CCDB · CromoCat 2015 — Gupta, R. C. & Gill, B. S. (1989). Cytopalynology of north and central Indian Compositae J. Cytol. Genet. 24: 96-105.
CCDB · CromoCat 2015 — Morton, J. K. (1981). Chromosome numbers in Compositae from Canada and the USA. Bot. J. Linn. Soc. 82: 357-368.
CCDB · CromoCat 2015 — Rehberger, U. (2000). In C. Dobeš & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna
CCDB · CromoCat 2015 — Mulligan, G. A. (1984). Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447-449.
CCDB · CromoCat 2015 — Mulligan, G.A. & W.J.Cody. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XL]. Taxon 22(2/3): 290-291.
CCDB · CromoCat 2015 — Powell, A. M., D. W. Kyhos & P. H. Raven. (1974). Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.
CCDB · CromoCat 2015 — Turner, B. L., W. L. Ellison & R. M. King. (1961). Chromosome numbers in the Compositae. IV. North American species, with phyletic interpretations. Amer. J. Bot. 48: 216-223.
n 2715×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · Cave1959 +1
CCDB · ipcn-api-dl — Chuang, F. M. 1984. In L.R. Heckard & J.C. Hickman, The phytogeographical significance of Snow Mountain, north coast ranges, California. Madroño 31: 30–47.
CCDB · ipcn-api-dl — UOTILA, P. & K. Pellinen. 1985. Chromosome numbers in vascular plants from Finland. Acta Bot. Fenn. 130.
CCDB · ipcn-api-dl — Keil, D. J. & D. J. Pinkava. 1976. Chromosome counts and taxonomic notes for Compositae from the United States and Mexico. Amer. J. Bot. 63: 1393–1403.
CCDB · book-ipcn73-74 — POJAR, J. 1973. Levels of polyploidy in four vegetation types of southwestern British Columbia. Canad. J. Bot. 51: 621-628. I
CCDB · Cave1959 — Ehrendorfer 1959b
CCDB · CromoCat 2015 — Ehrendorfer, F. (1953). Systematische und zytogenetische Untersuchungen an europäischen Rassen des Achillea-millefolium-Komplexes. Österr. Bot. Z. 100: 583-592.
CCDB · CromoCat 2015 — Schneider, I. (1957). Zytogenetische Untersuchungen an Sippen de Polyploid-Komplexes Achillea millefolium L. s. lat. Diss. Universität Wien pp. 86
CCDB · CromoCat 2015 — Schneider, I. (1958). Zytogenetische Untersuchungen an Sippen de Polyploid-Komplexes Achillea millefolium L. s. lat. (Zur Phylogenie der Gattung Achillea, I.) Österr. Bot. Z. 105: 11-158.
CCDB · CromoCat 2015 — Gervais, C. (1977). Cytological investigation of the Achillea millefolium complex (Compositae) in Quebec. Canad. J. Bot. 55: 796–808.
CCDB · CromoCat 2015 — Morton, J. K. (1981). Chromosome numbers in Compositae from Canada and the USA. Bot. J. Linn. Soc. 82: 357-368.
CCDB · CromoCat 2015 — Rehberger, U. (2000). In C. Dobeš & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna
CCDB · CromoCat 2015 — Uotila, P. & K. Pellinen. (1985). Chromosome numbers in vascular plants from Finland. Acta Bot. Fenn. 130: 1-37.
n 911×CCDB · iapt · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +1
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · book-ipcn65 — Mehra et al. 1965
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · ipcn-api-dl — Razaq, Z. A., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800–808.
CCDB · ipcn-api-dl — Pireh, W. & R. J. Tyrl. 1980. Cytogeography of Achillea millefolium in Oklahoma and adjacent States. Rhodora 80: 361–367.
CCDB · CromoCat 2015 — Mathew, A. & Mathew, P. M. (1988). Cytological studies on the south Indian Compositae Glimpses Pl. Res. 8: 1-177.
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
CCDB · CromoCat 2015 — Pireh, W. & R. J. Tyrl. (1980). Cytogeography of Achillea millefolium in Oklahoma and adjacent States. Rhodora 80: 361–367.
CCDB · CromoCat 2015 — Razaq, Z. A., A. A. Vahidy & S. I. Ali. (1994). Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800-808.
CCDB · CromoCat 2015 — Rostovtseva, T. S. (1979). Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Žurn. 64: 582-589.
n 281×CCDB · book-ipcn65
CCDB · book-ipcn65 — Laane 1965
n 291×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gupta, R. C. & Gill, B. S. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXI]. Taxon 30(2): 514.
n 361×CCDB · Cave1959
CCDB · Cave1959 — Ehrendorfer 1959b
n 451×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 581×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gupta, R. C. & Gill, B. S. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXI]. Taxon 30(2): 514.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
hexaploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
08Occurrence & distribution
Record type1 458 186 records
Wild obs. + sensor1 385 796
Museum / vouchered65 836
Cultivated / captive1 856
Other4 698
Origin
Native54 482
Introduced604
Range
Area of Occupancy AOO1 187 160 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy53% within 1 km
≤100 m 362 831≤1 km 246 889≤10 km 537 916>10 km 12 279
1 159 915 georeferenced · 225 881 without coordinates
Open the mapobservation + sensor1 385 796
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 5 172≤1 km 16 308≤10 km 30 351>10 km 1 285
53 116 georeferenced · 12 720 without coordinates
Open the institutions mapphysical evidence65 836
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy15% within 1 km
≤1 km 6≤10 km 16>10 km 19
41 georeferenced · 1 815 without coordinates
Open the mapnot free-living1 856
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions305 of 588 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 38 192 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 2 072 |
| Wuzhou, CN | 840 |
| Moscow State Universitylocation not on record | 791 |
| Kuopio, FI | 600 |
| Philadelphia, US | 551 |
| LDlocation not on record | 549 |
| Bronx, US | 468 |
| Chongqing Museumlocation not on record | 459 |
| BRNUlocation not on record | 399 |
| St. Paul, US | 388 |
| BFLlocation not on record | 361 |
| Salzburg, AT | 352 |
| Oulu, FI | 340 |
| Pullman, US | 314 |
| Corvallis, US | 312 |
| Université Lavallocation not on record | 299 |
| Vancouver, CA | 265 |
| WTUlocation not on record | 263 |
| Oskarshamn, SE | 257 |
| Santa Barbara, US | 254 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 232 |
| Bergen, NO | 226 |
| BDBClocation not on record | 221 |
| Uniwersytet Warszawskilocation not on record | 219 |
| Mexico City, MX | 217 |
| Claremont, US | 214 |
| San Diego, US | 206 |
| Denver, US | 203 |
| Moscow, US | 200 |
| WINlocation not on record | 194 |
| Riverside, US | 192 |
| Barcelona, ES | 187 |
| Jyväskylä, FI | 186 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 184 |
| Bloomington, US | 183 |
| Boise, US | 181 |
| University of Alberta Museumslocation not on record | 180 |
| Arcata, US | 179 |
| BClocation not on record | 174 |
| Québec, CA | 170 |
| Adam Mickiewicz University in Poznańlocation not on record | 169 |
| Garðabær, IS | 168 |
| Logan, US | 166 |
| University of Stellenboschlocation not on record | 163 |
| Berlin, DE | 163 |
| Turku, FI | 155 |
| Durango, MX | 147 |
| Victoria, CA | 147 |
| ASUlocation not on record | 145 |
| Trondheim, NO | 145 |
| Davis, US | 137 |
| Spearfish, US | 137 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 136 |
| Saint Louis, US | 135 |
| Ann Arbor, US | 132 |
| TROMlocation not on record | 129 |
| San Luis Obispo, US | 127 |
| Saint John, CA | 125 |
| Zürich, CH | 125 |
| Wlocation not on record | 122 |
| Missoula, US | 119 |
| Flagstaff, US | 118 |
| CASlocation not on record | 113 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 110 |
| University of New Hampshirelocation not on record | 110 |
| South Kensington, GB | 109 |
| Acadia Universitylocation not on record | 107 |
| Fort Worth, US | 102 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 100 |
| GZUlocation not on record | 99 |
| València, ES | 93 |
| SLU Artdatabankenlocation not on record | 92 |
| Yangling, CN | 86 |
| Tula State Universitylocation not on record | 85 |
| Provo, US | 83 |
| Bangkok, TH | 82 |
| College Park, US | 75 |
| Green Bay, US | 72 |
| Tallinn, EE | 71 |
| IFR-DNFlocation not on record | 71 |
| Caldwell, US | 70 |
| Chapel Hill, US | 70 |
| Mexico City, MX | 68 |
| US | 67 |
| Santa Cruz, US | 65 |
| Madison, US | 65 |
| New Haven, US | 65 |
| Albuquerque, US | 65 |
| Williamsburg, US | 63 |
| Stockholm, SE | 63 |
| 62 | |
| Christchurch, NZ | 60 |
| Uniwersytet Opolskilocation not on record | 60 |
| Pocatello, US | 60 |
| Montréal, CA | 59 |
| Görlitz, DE | 58 |
| MAlocation not on record | 57 |
| GJOlocation not on record | 56 |
| Austin, US | 54 |
| Toronto, CA | 53 |
| Museo Entomologico de Leonlocation not on record | 53 |
| Tartu, EE | 53 |
| Provincia di Livornolocation not on record | 51 |
| University of Lethbridgelocation not on record | 50 |
| Zürich, CH | 50 |
| Angwin, US | 49 |
| Hobart, AU | 49 |
| Allentown, US | 49 |
| University of Wisconsinlocation not on record | 46 |
| Auckland, NZ | 46 |
| Canadian Department of Agriculturelocation not on record | 45 |
| CICYTEXlocation not on record | 45 |
| Rocky Mountain Biological Laboratorylocation not on record | 45 |
| Pittsburg, US | 43 |
| Mount Annan, AU | 43 |
| Mlocation not on record | 43 |
| Entomological Society of Latvialocation not on record | 42 |
| Wellington, NZ | 42 |
| Emporia, US | 41 |
| QAUlocation not on record | 41 |
| Uppsala, SE | 40 |
| Odawara, JP | 38 |
| Canberra, AU | 37 |
| Whitewater, US | 37 |
| Helsinki, FI | 36 |
| EL PASO, US | 36 |
| Olocation not on record | 36 |
| Lubbock, US | 36 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 36 |
| KMNlocation not on record | 35 |
| Ashland, US | 35 |
| Karlsruhe, DE | 34 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 34 |
| GMBAlocation not on record | 33 |
| Turlock, US | 33 |
| UGentlocation not on record | 32 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 31 |
| Bozeman, US | 31 |
| Nagano City, JP | 30 |
| Western Carolina Universitylocation not on record | 30 |
| Weber State Universitylocation not on record | 30 |
| Palacký University in Olomouclocation not on record | 29 |
| San Sebastián, ES | 29 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 29 |
| Shinshu Universitylocation not on record | 28 |
| US | 28 |
| Millersville, US | 28 |
| Norfolk, US | 27 |
| Guasave, MX | 27 |
| Chapingo, MX | 26 |
| Lincoln, US | 26 |
| Porto Alegre, BR | 25 |
| Vitoria, ES | 24 |
| Adelaide, AU | 24 |
| Lord Fairfax Community Collegelocation not on record | 24 |
| Severin-McDaniel Insect Collectionlocation not on record | 24 |
| Philadelphia, US | 24 |
| Fayetteville, US | 24 |
| TUR-Alocation not on record | 24 |
| Yukon Universitylocation not on record | 23 |
| Pamplona, ES | 23 |
| Salamanca, ES | 23 |
| National Biodiversity Institute, Costa Ricalocation not on record | 22 |
| DOI/NPS, Greenbelt Parklocation not on record | 22 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 22 |
| Cheney, US | 22 |
| Beijing, CN | 22 |
| Rovaniemi, FI | 22 |
| Keene State Universitylocation not on record | 22 |
| MeiseBGlocation not on record | 21 |
| Guangzhou, CN | 21 |
| Northridge, US | 21 |
| Phoenix, US | 21 |
| Dekalb, US | 21 |
| WNNUlocation not on record | 20 |
| Orem, US | 20 |
| Trois-Rivières, CA | 20 |
| McWane Science Centerlocation not on record | 19 |
| KURAlocation not on record | 19 |
| Tsukuba, JP | 19 |
| Knoxville, US | 19 |
| Dresden, DE | 19 |
| PRClocation not on record | 18 |
| Kochi, JP | 18 |
| Chiba, JP | 18 |
| Anchorage, US | 17 |
| Kushiro City Museumlocation not on record | 17 |
| Tokushima, JP | 17 |
| Washington, US | 17 |
| Otaru, JP | 17 |
| Columbia, US | 17 |
| Johnson City, US | 16 |
| Natural History Museum Rotterdamlocation not on record | 16 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 16 |
| Frankfurt am Main | 16 |
| Davenport, US | 16 |
| Grand Junction, US | 16 |
| Tacoma, US | 16 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 16 |
| Obihiro Centennial City Museumlocation not on record | 16 |
| GB | 15 |
| Long Beach, US | 15 |
| San Angelo, US | 15 |
| Denton, US | 15 |
| Kew, GB | 15 |
| New Brunswick, US | 15 |
| Zapopan, MX | 15 |
| Rotorua, NZ | 14 |
| Tempe, US | 14 |
| Xian, CN | 14 |
| Dover, US | 14 |
| Sanda, JP | 14 |
| Jackson, US | 14 |
| Truckee, US | 14 |
| Mexico City, MX | 14 |
| Urumqi, CN | 14 |
| Uniwersytet Śląski w Katowicachlocation not on record | 14 |
| KIRMlocation not on record | 14 |
| Waverly, US | 14 |
| San Isidro, AR | 13 |
| Badajoz, ES | 13 |
| Tuscaloosa, US | 13 |
| San Francisco, US | 13 |
| Madrid, ES | 13 |
| Durban, ZA | 13 |
| Museum of the Rockieslocation not on record | 12 |
| Durango, US | 12 |
| Portland, US | 12 |
| Bando, JP | 12 |
| KOMlocation not on record | 12 |
| US | 12 |
| Mississippi State, US | 12 |
| Puebla, MX | 12 |
| Toyama, JP | 12 |
| University of Wisconsinlocation not on record | 12 |
| College of the Atlantic, Museumlocation not on record | 11 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 11 |
| SWlocation not on record | 11 |
| Chicago, US | 11 |
| Kirksville, US | 11 |
| AASlocation not on record | 11 |
| Fargo, US | 11 |
| JP | 11 |
| Urumqi, CN | 11 |
| Chicago, US | 11 |
| Hudson, US | 11 |
| San Jose, US | 11 |
| Brookings, US | 10 |
| DASSHlocation not on record | 10 |
| Córdoba, AR | 10 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 10 |
| University of Guelph, OAC Herbariumlocation not on record | 10 |
| Los Angeles, US | 10 |
| Miami, US | 10 |
| Walla Walla, US | 10 |
| Akita Prefectural Museumlocation not on record | 10 |
| UNESClocation not on record | 10 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 10 |
| University of Tennessee at Chattanoogalocation not on record | 10 |
| Pretoria, ZA | 10 |
| Ypsilanti, US | 10 |
| Brisbane, AU | 10 |
| USFS/BHSClocation not on record | 10 |
| Paris, FR | 10 |
| Blumenau, BR | 10 |
| Jena Microbial Resource Collectionlocation not on record | 10 |
| Macomb, US | 9 |
| Institute of the biological problems of the North FEB RASlocation not on record | 9 |
| Durham, US | 9 |
| Staten Island, US | 9 |
| AUAlocation not on record | 9 |
| Tomioka, JP | 9 |
| Fukushima Universitylocation not on record | 9 |
| Kingston, US | 9 |
| Bend, US | 9 |
| Parkville, AU | 9 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 9 |
| Universidad de Antioquia (UdeA)location not on record | 8 |
| SIHUlocation not on record | 8 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 8 |
| Bourges, FR | 8 |
| Clemson, US | 8 |
| Istituto Agrario Castelnuovolocation not on record | 8 |
| USFSlocation not on record | 8 |
| Eastern Nevada Landscape Coalitionlocation not on record | 8 |
| National Institute of Biological Resourceslocation not on record | 8 |
| Springfield, US | 7 |
| Appalachian State Universitylocation not on record | 7 |
| Burlington, US | 7 |
| Criciúma, BR | 7 |
| Fairfax, US | 7 |
| Fulda, DE | 7 |
| IDElocation not on record | 7 |
| SZUlocation not on record | 7 |
| Xian, CN | 7 |
| nbflocation not on record | 7 |
| Northeastern Forestry Universitylocation not on record | 7 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 7 |
| CJBGlocation not on record | 7 |
| Laboratory of Palaeontologylocation not on record | 7 |
| Hamilton, US | 7 |
| OLAlocation not on record | 6 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 6 |
| Edmonton, CA | 6 |
| Monastir, TN | 6 |
| KNFHClocation not on record | 6 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 6 |
| Tilburg, NL | 6 |
| Armidale, AU | 6 |
| Henderson State Universitylocation not on record | 6 |
| Puerto Ayora, EC | 6 |
| Kensington, AU | 6 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 6 |
| Universidad de Caldas (UCaldas)location not on record | 6 |
| Guatemala City, GT | 6 |
| Toluca, MX | 6 |
| Mount Pleasant, US | 6 |
| Universidad de Nariño (UdeNar)location not on record | 6 |
| Ivano-Frankivsk, UA | 6 |
| Seoul, KR | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| Winterthur, CH | 5 |
| Giardini Botanici Hanburylocation not on record | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Little Rock, US | 5 |
| US | 5 |
| Tromso University Museumlocation not on record | 5 |
| BIO-UNIPIlocation not on record | 5 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 5 |
| Granada, ES | 5 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 5 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 5 |
| Catalina Island Conservancylocation not on record | 5 |
| John T. Waterhouse Herbariumlocation not on record | 5 |
| STNFlocation not on record | 5 |
| University of Genevalocation not on record | 5 |
| Pelotas, BR | 5 |
| Tampa, US | 5 |
| Fort Bragg, US | 5 |
| DNSMlocation not on record | 5 |
| Baltimore, US | 5 |
| Ensenada, MX | 5 |
| Memorial University of Newfoundlandlocation not on record | 4 |
| Dehra Dun, IN | 4 |
| University of British Columbia, Herbariumlocation not on record | 4 |
| UFOPlocation not on record | 4 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 4 |
| BISHlocation not on record | 4 |
| Parthenon Tama History Museumlocation not on record | 4 |
| Juriquilla, MX | 4 |
| Taipei, TW | 4 |
| Nanjing, CN | 4 |
| IWEP FEB RASlocation not on record | 4 |
| BGBMlocation not on record | 4 |
| Forssa, FI | 4 |
| UoB-IBlocation not on record | 4 |
| Bern, CH | 4 |
| Universidad de La Salle (La Salle)location not on record | 4 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| Harrisonburg, US | 4 |
| Bureau of Land Managementlocation not on record | 4 |
| UFRRJlocation not on record | 4 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 4 |
| Research Collection of B. A. Bennettlocation not on record | 4 |
| La Paz, MX | 4 |
| Irvine, US | 4 |
| ENTClocation not on record | 4 |
| Tennessee Technological Universitylocation not on record | 4 |
| LfUlocation not on record | 4 |
| UnBlocation not on record | 4 |
| Alicante, ES | 4 |
| Zhejiang Universitylocation not on record | 4 |
| Uberlândia, BR | 4 |
| Conway, US | 4 |
| LPMMBHlocation not on record | 4 |
| Toyota city nature sanctuarylocation not on record | 3 |
| Honolulu, US | 3 |
| QVMAGlocation not on record | 3 |
| Kandalaksha State Nature Reservelocation not on record | 3 |
| PUC-RSlocation not on record | 3 |
| DBF-NHMDlocation not on record | 3 |
| Sendai, JP | 3 |
| Foz do Iguaçu, BR | 3 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 3 |
| Pamplona, ES | 3 |
| Science Museum of Minnesotalocation not on record | 3 |
| Xining, CN | 3 |
| INFlocation not on record | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| KNFYlocation not on record | 3 |
| Mohonk Preservelocation not on record | 3 |
| Göteborg, SE | 3 |
| Coimbra, PT | 3 |
| Universidad Nacional de Colombia (UNAL)location not on record | 3 |
| Lausanne, CH | 3 |
| H-Schuhwlocation not on record | 3 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 3 |
| Nishihara, JP | 3 |
| Smithsonian Institutionlocation not on record | 3 |
| University of Southern Mississippilocation not on record | 3 |
| Oswego, US | 3 |
| Whitehorse, CA | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| UEMlocation not on record | 3 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 3 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 3 |
| Taipei, TW | 3 |
| GAlocation not on record | 3 |
| Xiamen, CN | 3 |
| LINUlocation not on record | 3 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| Chicago, US | 3 |
| Kunming, CN | 3 |
| Ishikawa Museum of Natural Historylocation not on record | 3 |
| VALElocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Peking Universitylocation not on record | 3 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 3 |
| Nagatoro-machi, Chichibu-gun, JP | 3 |
| BSBIlocation not on record | 3 |
| Edinburgh, GB | 2 |
| Bureau of Land Management, Medford District Officelocation not on record | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Richmond, US | 2 |
| Shanghai, CN | 2 |
| Smithsonian Institution, National Museum of Natural Historylocation not on record | 2 |
| Minot State Universitylocation not on record | 2 |
| H-Dunkellocation not on record | 2 |
| Nanjing, CN | 2 |
| Minia, EG | 2 |
| Smithfield, AU | 2 |
| UNESP-FCAlocation not on record | 2 |
| Nishihara, JP | 2 |
| Bothell, US | 2 |
| San José, CR | 2 |
| San Francisco de Campeche, MX | 2 |
| Palmerston, AU | 2 |
| Hazara Universitylocation not on record | 2 |
| Cambridge, US | 2 |
| Arizona State University Biocollectionslocation not on record | 2 |
| Palmerston North, NZ | 2 |
| Santiago de Compostela, ES | 2 |
| MEXUlocation not on record | 2 |
| arosemena tola, EC | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| JBRJlocation not on record | 2 |
| Linares, MX | 2 |
| Namur, BE | 2 |
| UFPRlocation not on record | 2 |
| FUVATESlocation not on record | 2 |
| Philadelphia, US | 2 |
| Cascavel, BR | 2 |
| KR | 2 |
| Universidad del Quindío (UniQuindío)location not on record | 2 |
| HJAEFlocation not on record | 2 |
| Sagamihara, JP | 2 |
| Conway, US | 2 |
| Sant Julià de Lòria, AD | 2 |
| Sion, CH | 2 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 2 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Hiratsuka City Museumlocation not on record | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| Osaka, JP | 2 |
| Zacatecas, MX | 2 |
| Stephenville, US | 2 |
| Banyoles, ES | 2 |
| DMZ botanic gardenlocation not on record | 2 |
| Firenze, IT | 2 |
| Herb. BBGlocation not on record | 2 |
| Jefferson City, US | 2 |
| UNESP-FCAVlocation not on record | 2 |
| Bandelier National Monumentlocation not on record | 2 |
| San Luis Potosí, MX | 2 |
| McGill University, Herbariumlocation not on record | 1 |
| Viña del Mar, CL | 1 |
| UTFPR-DVlocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Arequipa, PE | 1 |
| UNICAMPlocation not on record | 1 |
| Kyoto Universitylocation not on record | 1 |
| AUT001location not on record | 1 |
| Cenargenlocation not on record | 1 |
| Volunteer State Community Collegelocation not on record | 1 |
| Students On Ice Foundationlocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| JBSlocation not on record | 1 |
| EEZA-CSIClocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Kiritappu Wetland National Trustlocation not on record | 1 |
| UNINE:NEUlocation not on record | 1 |
| Sevilla, ES | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Fullerton, US | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| University of Zhejianglocation not on record | 1 |
| Castelar, AR | 1 |
| FLASlocation not on record | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| UC Berkeley, Blue Oak Ranch Reservelocation not on record | 1 |
| La Trobe Universitylocation not on record | 1 |
| Santa Teresa, BR | 1 |
| Mexico City, MX | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Glarus, CH | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Nantes Culture Collectionlocation not on record | 1 |
| Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record | 1 |
| University of Victorialocation not on record | 1 |
| Pondicherry, IN | 1 |
| Research Collection of Jonathan Farrlocation not on record | 1 |
| Riobamba, EC | 1 |
| Mérida, MX | 1 |
| Chaguaramas, TT | 1 |
| UFSClocation not on record | 1 |
| Jaén, ES | 1 |
| Montréal, CA | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Sapporo, JP | 1 |
| Corrientes, AR | 1 |
| St. Augustine, TT | 1 |
| UIBlocation not on record | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Wuhan, CN | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Russellville, US | 1 |
| DULlocation not on record | 1 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 1 |
| M-VascularPlantslocation not on record | 1 |
| NoColllocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Korea National Arboretumlocation not on record | 1 |
| Decorah, US | 1 |
| National Museum Waleslocation not on record | 1 |
| BOISlocation not on record | 1 |
| Brock University (BU)location not on record | 1 |
| Seropédica, BR | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| UFBAlocation not on record | 1 |
| San Bernardino, US | 1 |
| DAOlocation not on record | 1 |
| KNAMlocation not on record | 1 |
| Porrentruy, CH | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| Tlalnepantla, MX | 1 |
| UChlocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| National Institute for Agricultural and Veterinarian Research, Portugallocation not on record | 1 |
| Zhuzhou, CN | 1 |
| USP-IBlocation not on record | 1 |
| Henderson, US | 1 |
| Fredericksburg, US | 1 |
| KNFSClocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Brasília, BR | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Mount Berry, US | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Riyadh Municipalitylocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| INMAlocation not on record | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| Durham, US | 1 |
| GINRlocation not on record | 1 |
| University of South Dakotalocation not on record | 1 |
| JMSlocation not on record | 1 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| UDESC-CAVlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| Nijmegen, NL | 1 |
| UFABClocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Université de Bordeauxlocation not on record | 1 |
| ROM007location not on record | 1 |
588 institutions · 62 967 of 65 836 vouchered records shown · 2 181 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA97 detections
Where the DNA of Achillea millefolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found97
Studies independent surveys1
Countries13
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 97 detections have coordinates
Open the map13 countries0
In dense marram/pea community.Rocky roadside.On ledges of rocky talus at base of shore cl…Dry meadow, sandy soil.lawnweed plant
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.8 °C 6.70–20.1
Seasonal swing summer↔winter25.8 °C
Max temp (day)18.2 °C 11.2–25.6
Min temp (night)10.0 °C 2.90–15.7
Precipitation80.9 mm/mo 53.6–120
Air humidity60.8 % 55.1–65.0
Moisture balance-31.4 mm/mo -74.6–94.5
Vapour deficit688 Pa 386–1,001
Wind speed3.50 m/s 2.30–5.80
Cloud cover44.2 % 34.7–64.3
CHELSA 1981–2010, ~9 km grid, at location & month of 74 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.