Achenomorphus corticinus

(Gravenhorst, 1802) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Achenomorphus

At a glance

Occurrence records670

Data sources5

Biological traits0

DNA specimens15

eDNA detections12

Sources5 archives

Databases and archives Achenomorphus corticinus's data was compiled from.

GBIFGlobal Biodiversity Information Facility670 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF670 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD15 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achenomorphus corticinus has left across the world's sequence archives.

At a glance

DNA specimens15

BINs2

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 54 variable positions, in barcode order

1Tmostly conserved

13Tmostly conserved

22Gmostly conserved

28Amostly conserved

50Tmostly conserved

59Tmostly conserved

76Amostly conserved

85Tmostly conserved

163Amostly conserved

169Amostly conserved

173Amostly conserved

181Amostly conserved

202Tmostly conserved

212Tmostly conserved

217Amostly conserved

223Tmostly conserved

229Amostly conserved

235Cmostly conserved

244Amostly conserved

268Tmostly conserved

271Tvariable

274Tmostly conserved

275Tmostly conserved

277Amostly conserved

283Amostly conserved

286Tmostly conserved

319Amostly conserved

343Tmostly conserved

346Tmostly conserved

355Tmostly conserved

364Tmostly conserved

370Tmostly conserved

373Amostly conserved

388Avariable

400Cmostly conserved

415Amostly conserved

428Tmostly conserved

433Amostly conserved

484Tmostly conserved

490Amostly conserved

496Amostly conserved

499Tmostly conserved

519Cmostly conserved

539Tmostly conserved

542Cmostly conserved

544Amostly conserved

550Tmostly conserved

562Amostly conserved

565Amostly conserved

601Tmostly conserved

628Gvariable

631Avariable

634Tmostly conserved

646Tmostly conserved

TACTTTATATTTTATTTTTGGGGCATGAGCTGGAATAGTTGGAACATCATTAAGATTATTAATTCGGGCAGAATTAGGAGTTCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes7

BINs2

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lithocharis ochraceasame family9.6%Sirdenus grayiisame order10.2%Telothyria duvalierbricenoisame order11.7%Syrphus vitripennissame order11.9%Eribolus nanasame order12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type670 records

Wild obs. + sensor277

Museum / vouchered393

Range

Area of Occupancy AOO1 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 163≤1 km 50≤10 km 8>10 km 16

237 georeferenced · 40 without coordinates

Open the mapobservation + sensor277

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 2≤1 km 2≤10 km 25

29 georeferenced · 364 without coordinates

Open the institutions mapphysical evidence393

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Tennessee at Chattanoogalocation not on record	137
University of Central Floridalocation not on record	115
Wuzhou, CN	102
University of Guelphlocation not on record	18
Lexington, US	8
OSUClocation not on record	3
University Park, US	3
CUlocation not on record	2
AHABlocation not on record	2
Cambridge, US	1
Saint John, CA	1

11 institutions · 392 of 393 vouchered records shown · 1 without an institution code

09Environmental DNA12 detections

Where the DNA of Achenomorphus corticinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

Mixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 15.8–25.8

Seasonal swing summer↔winter9.80 °C

Max temp (day)29.6 °C 20.7–29.6

Min temp (night)21.4 °C 11.4–22.4

Precipitation92.8 mm/mo 91.0–94.8

Air humidity59.4 % 56.5–59.4

Moisture balance-86.1 mm/mo -96.1–-39.2

Vapour deficit1,344 Pa 768–1,344

Wind speed2.80 m/s 2.70–5.90

Cloud cover28.4 % 27.8–42.7

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)