Achelia gracilis

Verrill, 1900 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Pycnogonida/Pantopoda/Ammotheidae/Achelia

At a glance

Occurrence records49

Data sources6

Biological traits2

DNA specimens13

eDNA detections13

Sources6 archives

Databases and archives Achelia gracilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility49 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF49 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD13 specimens

01Narrative

Achelia gracilis is een zeespin uit de familie Ammotheidae. De soort behoort tot het geslacht Achelia. Achelia gracilis werd in 1900 voor het eerst wetenschappelijk beschreven door Verrill.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achelia gracilis has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes2

eDNA detections13

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P610 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 71 variable positions, in barcode order

1Amostly conserved

34Tmostly conserved

43Tmostly conserved

55Avariable

59Cmostly conserved

61Cmostly conserved

64Cmostly conserved

74Cmostly conserved

82Amostly conserved

91Cmostly conserved

106Cmostly conserved

118Cmostly conserved

130Tmostly conserved

139Cmostly conserved

154Cmostly conserved

157Tmostly conserved

163Tmostly conserved

169Amostly conserved

181Tmostly conserved

190Amostly conserved

193Cmostly conserved

202Cmostly conserved

247Cmostly conserved

250Cmostly conserved

262Amostly conserved

265Amostly conserved

266Tmostly conserved

268Amostly conserved

271Amostly conserved

277Amostly conserved

286Tmostly conserved

287Cmostly conserved

298Tmostly conserved

328Tmostly conserved

331Gmostly conserved

334Cmostly conserved

337Cmostly conserved

340Cmostly conserved

347Cmostly conserved

352Tmostly conserved

364Amostly conserved

367Cmostly conserved

376Cmostly conserved

385Cmostly conserved

386Cmostly conserved

388Cmostly conserved

391Cvariable

400Tmostly conserved

403Cmostly conserved

415Gmostly conserved

418Amostly conserved

421Amostly conserved

439Tvariable

463Cmostly conserved

469Tmostly conserved

499Tmostly conserved

508Tmostly conserved

511Avariable

518Cmostly conserved

523Tmostly conserved

536Cmostly conserved

541Cmostly conserved

542Tmostly conserved

547Cmostly conserved

550Amostly conserved

556Amostly conserved

565Amostly conserved

568Cmostly conserved

578Cmostly conserved

589Cmostly conserved

607Amostly conserved

AACTATATATTTAATTTTTGGAATTTGAGCAGCTATAATAGGTACAGCATTAAGAATACTCATCCGAATTGAACTAGGAACACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.7%

Haplotypes7

BINs2

Most divergent pair11.3%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achelia sawayaisame genus14.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type49 records

Wild obs. + sensor3

Museum / vouchered46

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 46 records without

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	16
MNHN-location not on record	3
New Haven, US	1

3 institutions · 20 of 46 vouchered records shown · 26 without an institution code

09Environmental DNA13 detections

Where the DNA of Achelia gracilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 25.9–26.2

Seasonal swing summer↔winter2.10 °C

Max temp (day)26.9 °C 26.6–27.5

Min temp (night)25.4 °C 24.7–25.4

Precipitation179 mm/mo 159–204

Air humidity62.1 % 61.0–64.7

Moisture balance2.20 mm/mo

Vapour deficit1,283 Pa 1,174–1,323

Wind speed4.50 m/s

Cloud cover23.6 % 23.5–23.6

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)