Achelia echinata

Hodge, 1864 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Pycnogonida/Pantopoda/Ammotheidae/Achelia

At a glance

Occurrence records8 850

Data sources8

Biological traits4

DNA specimens12

eDNA detections3

Sources8 archives

Databases and archives Achelia echinata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 231 records↗

OBISOcean Biodiversity Information System4 619 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS8 850 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD12 specimens

01Narrative

De stekelzeespin is een zeespin uit de familie Ammotheidae. De soort behoort tot het geslacht Achelia. De stekelzeespin werd in 1864 voor het eerst wetenschappelijk beschreven door Hodge.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max14 m

Depth min0 m

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achelia echinata has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes3

eDNA detections3

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

290Tmostly conserved

323Amostly conserved

349Amostly conserved

374Cmostly conserved

AACAATGTATTTAATTTTTGGTGCATGAGCTGCTATGGTTGGAACTTCATTAAGATTTTTAATTCGAGTGGAATTAGGAACTCCATCTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type8 850 records

Wild obs. + sensor1 754

Museum / vouchered6 168

Other928

Origin

Native9

Range

Area of Occupancy AOO7 684 km²

Depth

0–200 m sunlit2 733

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 21.2 m · max 169 m · 2 733 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 1 406≤1 km 246≤10 km 38

1 690 georeferenced · 64 without coordinates

Open the mapobservation + sensor1 754

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 152≤1 km 55≤10 km 45>10 km 10

262 georeferenced · 5 906 without coordinates

Open the institutions mapphysical evidence6 168

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CEFASlocation not on record	1 869
DASSHlocation not on record	114
RWSlocation not on record	83
Paris, FR	63
Institut Francais pour l'Etude de la Merlocation not on record	48
730location not on record	37
National Marine Biodiversity Institute of Korealocation not on record	30
PNHSlocation not on record	15
486location not on record	14
CASlocation not on record	14
Universidade de Lisboa, Museu Bocagelocation not on record	13
Citadel Hill, GB	12
RBINS-Scientific Heritagelocation not on record	11
Biomorlocation not on record	10
Gothenburg, SE	9
Bergen, NO	8
Santa Barbara Museum of Natural Historylocation not on record	3
630location not on record	3
Goteborg Natural History Museumlocation not on record	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507) Université de Liège Underwater research and oceanographic station (4501)location not on record	1
Cambridge, US	1
NTNU-VMlocation not on record	1
Los Angeles, US	1
Washington, US	1
Hellenic Centre of Marine Research; Institute for Oceanographylocation not on record	1
South Kensington, GB	1
CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Phaxas Expertise Of Marine Fauna (4507)location not on record	1
CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record	1
P. P. Shirshov Institute of Oceanologylocation not on record	1

30 institutions · 2 369 of 6 168 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Achelia echinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 10.1–10.1

Seasonal swing summer↔winter10.7 °C

Max temp (day)11.8 °C

Min temp (night)7.90 °C

Precipitation93.6 mm/mo

Air humidity63.4 %

Moisture balance22.4 mm/mo

Vapour deficit469 Pa

Wind speed4.80 m/s

Cloud cover50.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Achelia echinata

At a glance

Sources8 archives

Habitat & environment2

Other traits2

At a glance

Record type8 850 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 850 records