Achatia distincta

Hübner, 1813 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Achatia

At a glance

Occurrence records2 827

Data sources7

Biological traits0

DNA specimens48

eDNA detections56

Sources7 archives

Databases and archives Achatia distincta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 827 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI56 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 827 records

Environmental DNA1 datasets · 2 countries56 detections

DNA & barcodingBOLD48 specimens

01Narrative

Achatia distincta, the distinct quaker, is a moth of the family Noctuidae. The species was first described by Jacob Hübner in 1813. It is found from coast to coast in most of United States and south-eastern Canada (from Quebec to Manitoba). The wingspan is 30–37 mm. Adults are on wing from late March to early May. There is one generation per year. The larvae feed on the leaves of ash, birch, butternut, flowering crabapple, grape, hickory, maple and oak.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achatia distincta has left across the world's sequence archives.

At a glance

DNA specimens48

BINs1

Marker genes1

eDNA detections56

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus48 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

40Gmostly conserved

100Amostly conserved

160Gmostly conserved

229Gmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTGGGAACTTCTTTAAGATTATTAATTCGAGCTGAACTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes11

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Orthosia populetisame family4.6%Perigrapha i-cinctumsame family4.6%Perigrapha cilissasame family4.6%Egira conspicillarissame family4.7%Orthosia annulimaculasame family4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 827 records

Wild obs. + sensor2 247

Museum / vouchered580

Range

Area of Occupancy AOO4 168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 205≤1 km 339≤10 km 118>10 km 170

1 832 georeferenced · 415 without coordinates

Open the mapobservation + sensor2 247

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 48≤1 km 158≤10 km 255>10 km 25

486 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence580

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	230
King Saud Universitylocation not on record	107
East Lansing, US	66
Colorado State Universitylocation not on record	46
University of Alberta Museums (UAM)location not on record	23
Georgia Museum of Natural Historylocation not on record	15
Helsinki, FI	11
ASUlocation not on record	10
St. Paul, US	9
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Toronto, CA	8
Cleveland Museum of Natural History, OH (CLEV)location not on record	6
CUlocation not on record	5
OSUClocation not on record	5
Cornell University Insect Collectionlocation not on record	3
Mississippi State, US	2
SOVTlocation not on record	2
University of Guelphlocation not on record	1
Biodiversity Institute of Ontariolocation not on record	1
UDlocation not on record	1

20 institutions · 559 of 580 vouchered records shown · 21 without an institution code

09Environmental DNA56 detections

Where the DNA of Achatia distincta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found56

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 56 detections have coordinates

Open the map2 countries0

Mixed habitat4. Native GrasslandTemperate mixed forestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 9.40–18.4

Seasonal swing summer↔winter26.1 °C

Max temp (day)19.3 °C 15.0–23.4

Min temp (night)8.80 °C 4.90–15.0

Precipitation92.6 mm/mo 81.9–115

Air humidity56.8 % 54.9–59.2

Moisture balance-39.0 mm/mo -49.6–16.1

Vapour deficit696 Pa 514–865

Wind speed3.50 m/s 2.70–5.20

Cloud cover43.6 % 40.0–47.3

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Achatia distincta

At a glance

Sources7 archives

At a glance

Record type2 827 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 827 records