Achaius oratorius

(Fabricius, 1793) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Ichneumonidae/Achaius

At a glance

Occurrence records2 188

Data sources8

Biological traits0

DNA specimens22

eDNA detections40

Sources8 archives

Databases and archives Achaius oratorius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 188 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 188 records

Environmental DNA3 datasets · 9 countries40 detections

DNA & barcodingBOLD22 specimens

Genome at a glanceGoaT · NCBI≈414 Mbp

01Narrative

Achaius oratorius is een insect dat behoort tot de orde vliesvleugeligen (Hymenoptera) en de familie van de gewone sluipwespen (Ichneumonidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd door Fabricius in 1793.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achaius oratorius has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections40

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

22Gmostly conserved

30Gmostly conserved

31Amostly conserved

32Gmostly conserved

34Amostly conserved

74Tmostly conserved

82Cmostly conserved

235Tmostly conserved

250Tmostly conserved

298Amostly conserved

317Tmostly conserved

439Tmostly conserved

469Tmostly conserved

475Tmostly conserved

538Tmostly conserved

539Cmostly conserved

542Cmostly conserved

562Amostly conserved

616Tmostly conserved

622Tmostly conserved

AGTATTATATTTTATATTTGGGATATGAAGAGGAATAATTGGATCTTCCATAAGATTAATTATTCGAATAGAATTAGGTAACCCCGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.87%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achaius margineguttatussame genus8.8%Diphyus gradatoriussame family8.8%Spilichneumon johansonisame family9.6%Limerodops elongatussame family9.6%Diphyus longigenasame family9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Achaius oratorius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈414 125 335 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Achaius oratorius0.41 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type2 188 records

Wild obs. + sensor1 928

Museum / vouchered255

Other5

Range

Area of Occupancy AOO4 788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 193≤1 km 65≤10 km 1 465

1 723 georeferenced · 205 without coordinates

Open the mapobservation + sensor1 928

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 131≤1 km 36≤10 km 25>10 km 2

194 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence255

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	44
SLU Artdatabankenlocation not on record	37
Provincia di Livornolocation not on record	29
Natural History Museum Rotterdamlocation not on record	21
neflocation not on record	9
BioFokuslocation not on record	5
ZSMlocation not on record	4
MZLUlocation not on record	4
NTNU-VMlocation not on record	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
NHMOlocation not on record	2
Brussels, BE	2
NCMGlocation not on record	2
South Kensington, GB	2
MNHWlocation not on record	1
Philadelphia, US	1
Nagatoro-machi, Chichibu-gun, JP	1
I.I. Schmalhausen Institute of Zoologylocation not on record	1
Helsinki, FI	1
Private Collection of H. Haraldseidelocation not on record	1
Champaign, US	1

21 institutions · 173 of 255 vouchered records shown · 82 without an institution code

09Environmental DNA40 detections

Where the DNA of Achaius oratorius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys3

Countries9

Verifiable raw sequence linked16

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map9 countries0

Forest edge

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 11.5–17.3

Seasonal swing summer↔winter18.3 °C

Max temp (day)18.2 °C 14.7–21.5

Min temp (night)10.7 °C 8.90–13.9

Precipitation72.5 mm/mo 59.2–160

Air humidity61.2 % 58.1–64.5

Moisture balance-24.5 mm/mo -47.1–131

Vapour deficit668 Pa 506–792

Wind speed3.20 m/s 2.30–4.50

Cloud cover47.1 % 36.2–55.6

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Achaius oratorius

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 188 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 188 records