Acetes sibogae

Hansen, 1919 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Acetidae/Acetes

At a glance

Occurrence records281

Data sources6

Biological traits8

DNA specimens14

eDNA detections15

Sources6 archives

Databases and archives Acetes sibogae's data was compiled from.

GBIFGlobal Biodiversity Information Facility109 records↗

OBISOcean Biodiversity Information System172 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS281 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD14 specimens

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length4 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max55 m

Depth min0 m

Vulnerability10

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acetes sibogae has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes1

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P549 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 54 variable positions, in barcode order

1Cmostly conserved

12Cmostly conserved

30Tmostly conserved

42Gmostly conserved

54Cmostly conserved

75Gmostly conserved

93Tmostly conserved

102Cmostly conserved

114Tmostly conserved

117Amostly conserved

132Amostly conserved

135Gmostly conserved

141Amostly conserved

162Gmostly conserved

171Tmostly conserved

213Amostly conserved

219Tmostly conserved

222Amostly conserved

225Amostly conserved

229Tmostly conserved

234Amostly conserved

237Amostly conserved

241Cmostly conserved

243Amostly conserved

255Amostly conserved

264Tmostly conserved

267Gmostly conserved

282Amostly conserved

288Gmostly conserved

294Tmostly conserved

306Cmostly conserved

309Amostly conserved

312Cmostly conserved

318Tmostly conserved

321Amostly conserved

327Cmostly conserved

339Amostly conserved

351Gmostly conserved

354Cmostly conserved

358Tmostly conserved

366Gmostly conserved

381Gmostly conserved

384Amostly conserved

411Tmostly conserved

441Cmostly conserved

450Cmostly conserved

456Cmostly conserved

459Gmostly conserved

480Cmostly conserved

486Gmostly conserved

493Cmostly conserved

499Tmostly conserved

525Tmostly conserved

543Gmostly conserved

CTAAGTCTTATCATTCGAGCAGAACTAGGTCAACCTGGTAGGCTAATTGGAGACGACCAGATTTATAACGTCGTGGTAACCGCTCACGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes4

BINs2

Most divergent pair9.3%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Metapenaeus lysianassasame order16.4%Glyphocrangon smithiisame order17.1%Metapenaeus joynerisame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type281 records

Wild obs. + sensor82

Museum / vouchered198

Other1

Range

Area of Occupancy AOO364 km²

Depth

0–200 m sunlit4

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 32.5 m · max 51 m · 4 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced · 78 without coordinates

Open the mapobservation + sensor82

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 86≤1 km 32≤10 km 8

126 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence198

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	60
Museum and Art Gallery of the Northern Territorylocation not on record	26
Natick, US	19

3 institutions · 105 of 198 vouchered records shown

09Environmental DNA15 detections

Where the DNA of Acetes sibogae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C

Min temp (night)19.3 °C

Precipitation109 mm/mo

Air humidity52.0 %

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa

Wind speed1.80 m/s

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)