Acetes indicus

H.Milne Edwards, 1830 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Acetidae/Acetes

At a glance

Occurrence records37

Data sources6

Biological traits8

DNA specimens136

eDNA detections137

Sources6 archives

Databases and archives Acetes indicus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 records↗

OBISOcean Biodiversity Information System19 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI137 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics136 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS37 records

Environmental DNA1 datasets · 2 countries137 detections

DNA & barcodingBOLD136 specimens

01Narrative

Acetes indicus is een tienpotigensoort uit de familie van de Sergestidae. De wetenschappelijke naam van de soort werd in 1830 voor het eerst geldig gepubliceerd door Henri Milne-Edwards.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2.5 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonepelagic

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max50 m

Depth min1 m

Vulnerability10

05DNA & barcoding136 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acetes indicus has left across the world's sequence archives.

At a glance

DNA specimens136

BINs2

Marker genes4

eDNA detections137

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P539 bp consensus128 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 48 variable positions, in barcode order

20Amostly conserved

23Amostly conserved

32Cmostly conserved

47Tmostly conserved

53Tmostly conserved

59Tmostly conserved

74Tmostly conserved

83Cmostly conserved

101Gmostly conserved

107Amostly conserved

110Cmostly conserved

128Tmostly conserved

138Tmostly conserved

143Tmostly conserved

146Amostly conserved

155Amostly conserved

161Cmostly conserved

176Tmostly conserved

182Gmostly conserved

191Tmostly conserved

207Tmostly conserved

209Amostly conserved

212Amostly conserved

219Cmostly conserved

230Tmostly conserved

245Tmostly conserved

254Gmostly conserved

275Tmostly conserved

278Tmostly conserved

293Tmostly conserved

299Amostly conserved

305Tmostly conserved

348Tmostly conserved

353Cmostly conserved

369Tmostly conserved

401Cmostly conserved

404Tmostly conserved

410Tmostly conserved

411Tmostly conserved

412Cmostly conserved

449Amostly conserved

461Cmostly conserved

476Amostly conserved

488Cmostly conserved

489Tmostly conserved

503Avariable

530Tmostly conserved

536Tmostly conserved

TTATTCGAGCAGAACTAGGACAACCAGGAAGCTTAATTGGAGATGATCAAATTTATAATGTAGTAGTTACAGCTCACGCTTTCATTATAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes11

BINs2

Most divergent pair9.1%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acetes serrulatussame genus13.0%Acetes japonicussame genus13.9%Dicranota persimilissame order15.2%Pagurus emmersonisame order15.4%Parasesarma plicatumsame order15.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P16S18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type37 records

Wild obs. + sensor25

Museum / vouchered10

Other2

Range

Area of Occupancy AOO72 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 28 m · max 28 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 25 records without

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	3
Museum für Naturkunde Berlin (Zoological Collections)location not on record	2
University of Dhaka, Department of Zoologylocation not on record	1

3 institutions · 6 of 10 vouchered records shown · 3 without an institution code

09Environmental DNA137 detections

Where the DNA of Acetes indicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found137

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 137 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 23.9–26.2

Seasonal swing summer↔winter7.20 °C

Max temp (day)28.9 °C 25.3–30.1

Min temp (night)22.5 °C 19.9–23.8

Precipitation109 mm/mo 44.2–201

Air humidity61.4 % 53.8–61.6

Moisture balance71.5 mm/mo

Vapour deficit1,320 Pa 1,165–1,557

Wind speed3.50 m/s

Cloud cover25.2 % 20.6–34.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)