Acetes americanus

Ortmann, 1893 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Acetidae/Acetes

At a glance

Occurrence records480

Data sources6

Biological traits5

DNA specimens58

eDNA detections37

Sources6 archives

Databases and archives Acetes americanus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility144 records↗

OBISOcean Biodiversity Information System336 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics58 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS480 records

Environmental DNA1 datasets · 1 countries37 detections

DNA & barcodingBOLD58 specimens

01Narrative

Acetes americanus is a small shrimp species in the family Sergestidae found in the western Atlantic Ocean between Brazil and the United States.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonepelagic

Other traits2

Depth max42 m

Depth min0 m

05DNA & barcoding58 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acetes americanus has left across the world's sequence archives.

At a glance

DNA specimens58

BINs3

Marker genes1

eDNA detections37

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P589 bp consensus58 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 53 variable positions, in barcode order

10Gmostly conserved

34Gvariable

41Cmostly conserved

49Amostly conserved

52Tmostly conserved

58Tvariable

59Tmostly conserved

67Gmostly conserved

70Cvariable

73Tvariable

136Tmostly conserved

139Cmostly conserved

145Cmostly conserved

148Gmostly conserved

151Amostly conserved

163Amostly conserved

164Cmostly conserved

169Tmostly conserved

178Amostly conserved

181Tmostly conserved

184Avariable

196Amostly conserved

208Tmostly conserved

220Amostly conserved

241Tmostly conserved

245Cmostly conserved

254Cmostly conserved

265Tmostly conserved

269Tmostly conserved

283Amostly conserved

289Gmostly conserved

331Tmostly conserved

340Tvariable

352Tmostly conserved

364Cvariable

370Amostly conserved

376Amostly conserved

379Tmostly conserved

385Cmostly conserved

403Cmostly conserved

409Tmostly conserved

418Tmostly conserved

430Cmostly conserved

457Cmostly conserved

463Tmostly conserved

467Tmostly conserved

481Tmostly conserved

484Tmostly conserved

515Cvariable

545Cvariable

553Tmostly conserved

563Tmostly conserved

583Tmostly conserved

AATAGTAGGGACCTCTTTAAGATTAATTATTCGGGCAGAACTAGGACAACCTGGTAGTTTAATTGGGGACGATCAAATTTACAATGTAGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes9

BINs3

Most divergent pair7.8%

S.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eumunida funambulussame order16.5%Metapenaeopsis stridulanssame order16.8%Discorsopagurus schmittisame order16.8%Manningia pilaensissame order17.0%Cestopagurus timidussame order17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type480 records

Wild obs. + sensor204

Museum / vouchered234

Cultivated / captive26

Other16

Origin

Native4

Range

Area of Occupancy AOO572 km²

Depth

0–200 m sunlit262

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5.8 m · max 135 m · 262 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤1 km 4>10 km 2

6 georeferenced · 198 without coordinates

Open the mapobservation + sensor204

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 232 without coordinates

Open the institutions mapphysical evidence234

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 26 records without

Open the mapnot free-living26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	78
Cambridge, US	4
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	4
Texas Cooperative Wildlife Collectionlocation not on record	4
PUC-RSlocation not on record	2
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	1
FCMMlocation not on record	1
Instituto de Investigaciones Marinas y Costeras José Benito Vives de Andreis - Invemarlocation not on record	1
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	1
South Kensington, GB	1

10 institutions · 97 of 234 vouchered records shown · 17 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA37 detections

Where the DNA of Acetes americanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter2.20 °C

Max temp (day)30.2 °C

Min temp (night)21.3 °C

Precipitation164 mm/mo

Air humidity64.0 %

Moisture balance32.9 mm/mo

Vapour deficit1,154 Pa

Wind speed1.10 m/s

Cloud cover45.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)