Acerpenna macdunnoughi

(Ide, 1937) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Ephemeroptera/Baetidae/Acerpenna

At a glance

Occurrence records200

Data sources8

Biological traits0

DNA specimens209

eDNA detections203

Sources8 archives

Databases and archives Acerpenna macdunnoughi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility200 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI203 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics209 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF200 records

Environmental DNA1 datasets · 2 countries203 detections

DNA & barcodingBOLD209 specimens

01Narrative

Acerpenna macdunnoughi is a species of small minnow mayfly in the family Baetidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding209 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acerpenna macdunnoughi has left across the world's sequence archives.

At a glance

DNA specimens209

BINs1

Marker genes1

eDNA detections203

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P590 bp consensus201 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

28Tvariable

55Tvariable

157Tmostly conserved

160Gmostly conserved

199Tmostly conserved

266Tmostly conserved

307Gmostly conserved

379Gmostly conserved

487Tmostly conserved

514Gmostly conserved

517Tmostly conserved

532Cvariable

577Tmostly conserved

580Tmostly conserved

GGTAGGTACCTCTCTTAGTTTACTAATTCGGGCAGAGTTAGGTAACCCAGGGTCTCTCATTGGAGACGATCAAATTTATAATGTTATTGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes18

BIN1

Most divergent pair3.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pseudocentroptiloides usasame family16.8%Labiobaetis aldabaesame family17.1%Callibaetis pretiosussame family17.3%Baetis rhodanisame family17.3%Acentrella verasame family17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type200 records

Wild obs. + sensor106

Museum / vouchered94

Range

Area of Occupancy AOO464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 106

106 georeferenced

Open the mapobservation + sensor106

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 43≤1 km 9

52 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence94

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	50
Illinois Natural History Surveylocation not on record	7
Tempe, US	4
Georgia Museum of Natural Historylocation not on record	1
Drexel University, Academy of Natural Scienceslocation not on record	1

5 institutions · 63 of 94 vouchered records shown · 31 without an institution code

09Environmental DNA203 detections

Where the DNA of Acerpenna macdunnoughi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found203

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 203 detections have coordinates

Open the map2 countries0

StreamRiver

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 7.70–19.7

Seasonal swing summer↔winter23.7 °C

Max temp (day)17.6 °C 12.1–21.4

Min temp (night)10.0 °C 3.50–15.5

Precipitation93.8 mm/mo 86.5–102

Air humidity56.4 % 54.6–59.0

Moisture balance-8.60 mm/mo -46.9–18.8

Vapour deficit737 Pa 475–877

Wind speed3.60 m/s 2.20–4.50

Cloud cover42.5 % 41.0–45.1

CHELSA 1981–2010, ~9 km grid, at location & month of 201 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)