Aceria litchii

(Keifer, 1943) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Trombidiformes/Eriophyidae/Aceria

At a glance

Occurrence records59

Data sources6

Biological traits0

DNA specimens11

eDNA detections11

Sources6 archives

Databases and archives Aceria litchii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility59 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF59 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

O ácaro-da-erinose-da-lichia, considerado a principal praga da lichia, ataca, sobretudo, as folhas da porção terminal dos ramos, porém, em casos mais severos de infestação, atinge as inflorescências e frutos, podendo comprometer a produção. Entre os sintomas do ataque estão o enrugamento das folhas e a formação de bolhas na epiderme foliar.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aceria litchii has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes2

eDNA detections11

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

1Gmostly conserved

5Cmostly conserved

GACTCTTTATTTCATTTTTGGATTTTGGAGAGCTTTTTATGGTACTTCCTTGAGCTTGCTAATACGTTTAGAGTTAGGTCAGTTGGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes3

BIN1

Most divergent pair0.30%

Asia

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type59 records

Wild obs. + sensor31

Museum / vouchered28

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 17≤1 km 3>10 km 5

25 georeferenced · 6 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 28 records without

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
DPIlocation not on record	16

1 institutions · 16 of 28 vouchered records shown · 12 without an institution code

09Environmental DNA11 detections

Where the DNA of Aceria litchii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 21.4–21.4

Seasonal swing summer↔winter15.3 °C

Max temp (day)24.5 °C

Min temp (night)17.8 °C

Precipitation285 mm/mo

Air humidity66.8 %

Moisture balance180 mm/mo

Vapour deficit845 Pa

Wind speed3.00 m/s

Cloud cover53.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)