Acer pseudoplatanus
speciesAt a glance
Occurrence records1 106 172
Data sources14
Biological traits150
DNA specimens82
eDNA detections546
Sources14 archives
Databases and archives Acer pseudoplatanus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 106 172 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI546 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics82 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources150 traits
Chemical compositionLOTUS6 compounds
Occurrence & distributionGBIF1 106 172 records
Environmental DNA4 datasets · 15 countries546 detections
DNA & barcodingBOLD · NCBI82 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex1.6 Gbp
01Narrative
L’érable sycomore est une espèce d'arbres de grande taille de la famille des acéracées fréquente en Europe. Il appartient à la section Acer de la classification des érables selon de Jong (1976). Il s'agit d'un arbre à croissance rapide les premières années, et qui rejette facilement de souche quand il est coupé. L'érable sycomore ne doit pas être confondu avec l’espèce voisine Acer platanoides, l'érable plane ou érable platane dont le bout des feuilles est plus acéré. Selon l'ENGREF l'érable sycomore serait plus sensible à la maladie de la cime mais moins exigeant en lumière et moins xérophile que l'érable plane. On l'appelle parfois faux platane, grand érable, ou érable de montagne, plus rarement érable blanc.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology24
Fruit length45 mm
Inflorescence length max15 cm
Inflorescence length min5 cm
Leaf length150 mm
Leaf length max300 mm
Leaf length min100 mm
Leaf size10 645 mm²
⚠ sources differ — TRY: 10 645 mm² · LEDA: 8 150 mm² · GIFT: 8 365 mm²
Leaf width115 mm
⚠ sources differ — AusTraits: 115 mm · GIFT: 150 mm
Leaf width max220 mm
Leaf width min80 mm
Petiole length7 cm
Plant height21.93 m
⚠ sources differ — GIFT: 21.93 m · AusTraits: 30 m · LEDA: 27.5 m · USDA: 21.34 m · TRY: 4.15 m
Plant height generative22.5 m
Plant height max40 m
Plant height min8 m
Seed length44.17 mm
⚠ sources differ — TRY: 44.17 mm · GIFT: 6.4 mm
Seed length max6.4 mm
Seed length min6.4 mm
Seed mass94.58 mg
⚠ sources differ — TRY: 94.58 mg · LEDA: 44.8 mg · GIFT: 94.66 mg
Seed mass max134 mg
Seed mass min59.86 mg
Seed width5 mm
Seed width max5 mm
Seed width min5 mm
Life cycle & reproduction38
Bloom periodLate Spring
Coppice potentialNo
DeciduousnessDeciduous
⚠ sources differ — TRY: Deciduous · GIFT: deciduous
Dispersal typeanimal
⚠ sources differ — LEDA: dysochor · GIFT: anemochorous
Flower colourgreen
Flower conspicuousNo
Flower length max5 mm
Flower length min4 mm
Flowering endJun
Flowering startApr
Flowering timennnnnnnnyyyn
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDAModerate
Life formtree
Life spanperennial
Lifespan categoryModerate
Lifespan years418 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Reproduction asexualabsent
Resprout abilityYes
Seed number870
Seed spread rateModerate
Seedling vigorMedium
Self fertilizationabsent
Sex typemonoecious
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment31
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorYellow-Green
Foliage porosity summerDense
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourgreen
Fruit typesamara
Growth formtree
⚠ sources differ — GIFT: tree · AusTraits: tree · TRY: Angiosperm
Growth form USDASingle Stem
Habitat GIFTforest, mountains, plains, rivers, roadsides, stony places
Hedge toleranceMedium
Known allelopathNo
Leaf compoundnesssimple
Leaf formlobed
Leaf retentionNo
Leaf shapeoblong ovate
Low growing grassNo
Mycorrhizaabsent
Mycorrhiza typeAMNM
Root depth min48 in
Shape and orientationErect
Small grainNo
Woodinesswoody
Physiology & chemistry29
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredYes
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min140 days
Leaf C:N ratio17.63 g/g
Leaf c473 mg/g
Leaf dry-matter content (LDMC)347 mg/g
⚠ sources differ — TRY: 347 mg/g · LEDA: 264 mg/g
Leaf n25.33 mg/g
Leaf p1.77 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min32 in
Protein potentialLow
Salinity toleranceMedium
Seed longevity index0
Shade toleranceHigh
Soil pH max7 pH
Soil pH min5.8 pH
Specific leaf area (SLA)13.97 mm²/mg
⚠ sources differ — TRY: 13.97 mm²/mg · LEDA: 16.29 mm²/mg · GIFT: 16.68 mm²/mg
Temperature min-23 °F
Wood density525 mg/cm³
⚠ sources differ — TRY: 525 mg/cm³ · GIFT: 620 mg/cm³
Uses & economy16
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Fuelwood productMedium
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound5 920 per lb
ToxicityNone
Veneer productNo
Other traits10
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceNo
Height at 20yr18.29 m
Inflorescencepanicle
Planting density max700 per acre
Planting density min300 per acre
Seeds per fruit>1000
03Chemical composition6 compounds
Compounds documented for Acer pseudoplatanus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Anthocyanidins4
Purine alkaloids1
Aminoacids $ Dipeptides1
Documented compounds6 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2S)-2-amino-5-[[(S)-carboxy-[(1S)-2-methylidenecyclopropyl]methyl]amino]-5-oxopentanoic acid | present | LOTUS | |
| 2-(Hydroxymethyl)-5-[6-[(4-hydroxy-3-methylbut-2-enyl)amino]purin-9-yl]oxolane-3,4-diol | present | LOTUS | |
| Cyanidin 3-glucoside | present | LOTUS | |
| Cyanidin 3-rutinoside | present | LOTUS |
05DNA & barcoding82 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acer pseudoplatanus has left across the world's sequence archives.
At a glance
DNA specimens82
Marker genes6
GenBank sequences9
eDNA detections546
Countries15
The DNA barcodea real sequence read deposited for this species
CCCCCCCCAAACCCCTCCCCTCTCGAAACAGAGAGACGAGGGGACTTGGCCGTGGGCGGATATTGGCCTCCCGTGTGCCGAACGGCCTGC …
Acer pseudoplatanus voucher EDNA21-0060755 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★rbcLa★ITS8★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Acer pseudoplatanus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 555 020 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Acer pseudoplatanus1.56 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 52 n = 26
Ploidy4× tetraploid · measured
Chromosome records52–1422n range52median52mode33records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 5232×GoaT · Tree of Sex Database · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +9
GoaT · Tree of Sex Database — ↗
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3148
CCDB · fl-europaea — Lovkvist, 1963
CCDB · poland — Pogan E., Wcis?o H., Jankun A. et al. 1980 b. Further studies in chromosome numbers of Polish Angiosperms. Part XIII. Acta Biol. Cracov. Ser. Bot. 22, 37-69.
CCDB · mediterranean
CCDB · ipcn-api-dl — Santamour, F. S. J. 1988. New chromosome counts in Acer (maple) species, sections Acer and Goniocarpa. Rhodora 90: 127–131.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Pogan, E., H. Wcislow & A. Jankun. 1980. Further studies in chromosome numbers of Polish Angiosperms Part XlIl. Acta Biol. Cracov., Ser. Bot. 22: 37–69.
CCDB · ipcn-api-dl — Ferakova, V. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Goranova, V. 2006. Mediterranean chromosome number reports 16 (1572--1583). Fl. Medit. 16: 425–431.
CCDB · ipcn-api-dl — Petrova, A. 2006. Mediterranean chromosome number reports 16 (1584--1603). Fl. Medit. 16: 431–442.
CCDB · ipcn-api-dl — Ivanova. 2005. Mediterranean chromosome number reports 15 (1445--1456). Fl. Medit. 15: 719–728.
CCDB · book-atlas-flowering-plants — Foster 1933 (ASu)W Eur., S.W. Asia
CCDB · kew — Siljak-Yakovlev S, Pustahija F, Šolic EM, Bogunic F, Muratovic E, Bašic N, Catrice O, Brown SC. 2010. Towards a genome size and chromosome number database of Balkan flora: C-values in 343 taxa with novel values for 242. Advanced Science Letters 3: 190-213
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
CCDB · CromoCat 2015 — Goranova, V., Stanimirova, P. & An?ev, M. (2006). Reports (1572-1583). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-16 Fl. Medit. 16: 425-431
CCDB · CromoCat 2015 — Ivanova, D., Vladimirov, V. & Stanimirova, P. (2005). Reports (1445-1456). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-15 Fl. Medit. 15: 719-728
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Petrova, A., Zieli?ski, J. & Natcheva, R. (2006). Reports (1584-1603). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-16 Fl. Medit. 16: 431-442
CCDB · CromoCat 2015 — Siljak-Yakovlev, S., Pustahija, F., Šoli?, E.M., Boguni?, F., Muratovi?, E., Baši?, N., Catrice, O. & S. C. Brown. (2010). Towards a Genome Size and Chromosome Number Database of Balkan Flora: C-Values in 343 Taxa with Novel Values for 242 Advanced Scienc
TreeOfSex · plant — Goldblatt1979 ↗
2n 1421×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database — ↗
n 267×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · CromoCat 2015 +1
CCDB · ipcn-api-dl — Santamour, F. S. J. 1988. New chromosome counts in Acer (maple) species, sections Acer and Goniocarpa. Rhodora 90: 127–131.
CCDB · ipcn-api-dl — Mehra, P. N. 1976. Cytology of Himalayan Hardwoods. Sree Saraswaty Press, Calcutta.
CCDB · book-ipcn73-74 — MEHRA, P.N., P.K. KHOSLA, & T.S. SAREEN. 1972. . Cy t ogenet1cal stu d. 1esI of Himalayan Aceraceae, Hippocastanaceae, sapindaceae and staphyleace~ Silvae Genet. 21: 96-102.
CCDB · CromoCat 2015 — Goranova, V., Stanimirova, P. & An?ev, M. (2006). Reports (1572-1583). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-16 Fl. Medit. 16: 425-431
CCDB · CromoCat 2015 — Santamour, F. S. Jr. (1988). New chromosome counts in Acer (maple) species, sections Acer and Goniocarpa Rhodora 90: 127-131
TreeOfSex · plant — Goldblatt1979 ↗
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type1 106 172 records
Wild obs. + sensor1 016 518
Museum / vouchered20 276
Cultivated / captive62 252
Fossil11
Other7 115
Origin
Native1 123
Introduced17 187
Range
Area of Occupancy AOO623 664 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy53% within 1 km
≤100 m 244 246≤1 km 202 241≤10 km 392 140>10 km 4 269
842 896 georeferenced · 173 622 without coordinates
Open the mapobservation + sensor1 016 518
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy34% within 1 km
≤100 m 1 329≤1 km 4 181≤10 km 10 729>10 km 112
16 351 georeferenced · 3 925 without coordinates
Open the institutions mapphysical evidence20 276
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy76% within 1 km
≤100 m 156≤10 km 33>10 km 15
204 georeferenced · 62 048 without coordinates
Open the mapnot free-living62 252
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions132 of 234 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 13 300 |
| Salzburg, AT | 596 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 574 |
| BFLlocation not on record | 479 |
| BIO-UNIPIlocation not on record | 340 |
| LDlocation not on record | 202 |
| Karlsruhe, DE | 188 |
| Trondheim, NO | 173 |
| Olocation not on record | 163 |
| Görlitz, DE | 162 |
| MeiseBGlocation not on record | 162 |
| Berlin, DE | 101 |
| Uniwersytet Warszawskilocation not on record | 90 |
| Moscow State Universitylocation not on record | 89 |
| Mlocation not on record | 88 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 88 |
| M-Lichenslocation not on record | 80 |
| KMNlocation not on record | 80 |
| MAlocation not on record | 78 |
| Bergen, NO | 73 |
| Oskarshamn, SE | 66 |
| Provincia di Livornolocation not on record | 65 |
| Entomological Society of Latvialocation not on record | 65 |
| Uniwersytet Opolskilocation not on record | 60 |
| Adam Mickiewicz University in Poznańlocation not on record | 56 |
| SLU Artdatabankenlocation not on record | 55 |
| Christchurch, NZ | 51 |
| Allentown, US | 48 |
| Philadelphia, US | 47 |
| South Kensington, GB | 45 |
| TROMlocation not on record | 45 |
| Bronx, US | 42 |
| Chongqing Museumlocation not on record | 38 |
| BClocation not on record | 38 |
| UniKSlocation not on record | 38 |
| Barcelona, ES | 37 |
| Bern, CH | 37 |
| Vitoria, ES | 36 |
| València, ES | 36 |
| CJBGlocation not on record | 29 |
| Frankfurt am Main | 29 |
| BRNUlocation not on record | 28 |
| Auckland, NZ | 27 |
| Tartu, EE | 27 |
| WTUlocation not on record | 26 |
| UGentlocation not on record | 25 |
| BDBClocation not on record | 25 |
| CICYTEXlocation not on record | 23 |
| Vancouver, CA | 23 |
| Dresden, DE | 23 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 21 |
| Rotorua, NZ | 20 |
| Adelaide, AU | 20 |
| Helsinki, FI | 19 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 18 |
| College of the Atlantic, Museumlocation not on record | 18 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 18 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 18 |
| Uniwersytet Jagiellońskilocation not on record | 18 |
| University of Stellenboschlocation not on record | 17 |
| Universidade de Lisboa, Museu Bocagelocation not on record | 17 |
| Porrentruy, CH | 17 |
| New Haven, US | 16 |
| Museo Entomologico de Leonlocation not on record | 16 |
| Hobart, AU | 15 |
| Museo Achille Folettolocation not on record | 15 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 15 |
| Zürich, CH | 15 |
| Madrid, ES | 15 |
| Salamanca, ES | 14 |
| Stockholm, SE | 14 |
| Millersville, US | 14 |
| Burlington, US | 14 |
| San Sebastián, ES | 14 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 13 |
| Wlocation not on record | 13 |
| University of New Hampshirelocation not on record | 13 |
| College Park, US | 12 |
| Mount Annan, AU | 11 |
| GZUlocation not on record | 11 |
| Dekalb, US | 11 |
| Corvallis, US | 10 |
| Podgorica, ME | 10 |
| Tallinn, EE | 10 |
| GJOlocation not on record | 10 |
| Denver, US | 10 |
| Moscow, US | 10 |
| Staten Island, US | 10 |
| ISAlocation not on record | 9 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 9 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 9 |
| Canberra, AU | 9 |
| Portland, US | 9 |
| Uppsala, SE | 9 |
| Natural History Museum Rotterdamlocation not on record | 8 |
| Acadia Universitylocation not on record | 8 |
| Kuopio, FI | 8 |
| Kew, GB | 7 |
| Fulda, DE | 7 |
| Sion, CH | 7 |
| Washington, US | 7 |
| Davenport, US | 6 |
| Glarus, CH | 6 |
| BSBIlocation not on record | 6 |
| Saint John, CA | 6 |
| New Brunswick, US | 6 |
| Granada, ES | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| Armidale, AU | 6 |
| DBF-NHMDlocation not on record | 6 |
| Philadelphia, US | 6 |
| PRClocation not on record | 5 |
| Santa Barbara, US | 5 |
| PrivatHerblocation not on record | 5 |
| Tilburg, NL | 5 |
| Philadelphia, US | 5 |
| Pamplona, ES | 5 |
| Kingston, US | 5 |
| Wellington, NZ | 4 |
| Missoula, US | 4 |
| University of Alberta Museumslocation not on record | 4 |
| Zürich, CH | 4 |
| Toronto, CA | 4 |
| Bourges, FR | 4 |
| Phyletisches Museum Jenalocation not on record | 4 |
| Badajoz, ES | 4 |
| SZUlocation not on record | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| Cincinnati, US | 3 |
| Saint Louis, US | 3 |
| Riverside, US | 3 |
| Voronezh State Universitylocation not on record | 3 |
| Tampa, US | 3 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| Cheney, US | 3 |
| Alicante, ES | 3 |
| Jyväskylä, FI | 3 |
| McWane Science Centerlocation not on record | 3 |
| Pocatello, US | 3 |
| Ivano-Frankove, UA | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Chapingo, MX | 3 |
| Monastir, TN | 3 |
| Paris, FR | 3 |
| TUR-Alocation not on record | 3 |
| Taipei, TW | 3 |
| Jaén, ES | 3 |
| nbflocation not on record | 2 |
| Bangkok, TH | 2 |
| Weber State Universitylocation not on record | 2 |
| Bloomington, US | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Namur, BE | 2 |
| SWlocation not on record | 2 |
| UFRRJlocation not on record | 2 |
| Montréal, CA | 2 |
| JBRJlocation not on record | 2 |
| Tromso University Museumlocation not on record | 2 |
| Northridge, US | 2 |
| Durham, US | 2 |
| *unvoucheredlocation not on record | 2 |
| Turku, FI | 2 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 2 |
| UNESP-FCAlocation not on record | 2 |
| Santiago de Compostela, ES | 2 |
| Columbia, US | 2 |
| Provo, US | 2 |
| Madrid, ES | 2 |
| Pamplona, ES | 2 |
| Chapel Hill, US | 2 |
| FLADlocation not on record | 1 |
| Winterthur, CH | 1 |
| Macomb, US | 1 |
| Banyoles, ES | 1 |
| Durango, MX | 1 |
| Xiamen, CN | 1 |
| Keene State Universitylocation not on record | 1 |
| Hudson, US | 1 |
| Durban, ZA | 1 |
| Mohonk Preservelocation not on record | 1 |
| Garðabær, IS | 1 |
| Logan, US | 1 |
| Mexico City, MX | 1 |
| Claremont, US | 1 |
| QVMAGlocation not on record | 1 |
| PUC-RSlocation not on record | 1 |
| Edinburgh, GB | 1 |
| Ann Arbor, US | 1 |
| UoB-IBlocation not on record | 1 |
| Pullman, US | 1 |
| US | 1 |
| US | 1 |
| Long Beach, US | 1 |
| Université Lavallocation not on record | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Beijing, CN | 1 |
| H-AkrKGlocation not on record | 1 |
| Victoria, CA | 1 |
| Firenze, IT | 1 |
| Universidad Nacional del Comahuelocation not on record | 1 |
| Viña del Mar, CL | 1 |
| IPE-CSIClocation not on record | 1 |
| Seropédica, BR | 1 |
| Clemson, US | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| LfUlocation not on record | 1 |
| EL PASO, US | 1 |
| Fullerton, US | 1 |
| CJBNlocation not on record | 1 |
| Arequipa, PE | 1 |
| Ashland, US | 1 |
| Boise, US | 1 |
| Caldwell, US | 1 |
| Frauenfeld, CH | 1 |
| BAYLUlocation not on record | 1 |
| Mount Pleasant, US | 1 |
| Flagstaff, US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Wuzhou, CN | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| ASUlocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Fribourg, CH | 1 |
| AUAlocation not on record | 1 |
| Córdoba, ES | 1 |
| H-Schuhwlocation not on record | 1 |
| Kensington, AU | 1 |
| H-Wolflocation not on record | 1 |
| ESP003location not on record | 1 |
234 institutions · 19 262 of 20 276 vouchered records shown · 701 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA546 detections
Where the DNA of Acer pseudoplatanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found546
Studies independent surveys4
Countries15
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 546 detections have coordinates
Open the map15 countries0
wood along river edge
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.3 °C 10.9–17.4
Seasonal swing summer↔winter17.5 °C
Max temp (day)15.1 °C 14.4–21.7
Min temp (night)8.10 °C 7.30–12.9
Precipitation74.2 mm/mo 72.1–108
Air humidity62.5 % 58.3–64.9
Moisture balance10.6 mm/mo -25.3–22.5
Vapour deficit552 Pa 459–804
Wind speed3.80 m/s 2.20–4.50
Cloud cover41.8 % 33.4–44.9
CHELSA 1981–2010, ~9 km grid, at location & month of 531 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.