Acentronura tentaculata

Günther, 1870 · species

image placeholder — illustration coming later

Animalia/Chordata/Syngnathiformes/Syngnathidae/Acentronura

At a glance

Occurrence records42

Data sources9

Biological traits6

DNA specimens4

eDNA detections4

Sources9 archives

Databases and archives Acentronura tentaculata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility34 records↗

OBISOcean Biodiversity Information System8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS42 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Acentronura tentaculata, the shortpouch pygmy pipehorse , northern little pipehorse, or dwarf pipehorse, is a species of pygmy pipehorse from the family Syngnathidae. The status of this species is debated and Acentronura breviperula is considered to be subsumed within this species by some authorities. The exact distribution of this species may be as wide as the western Indo-Pacific region from East Africa to New Caledonia and the northern Great Barrier Reef. Other authorities however describe Acentronura tentaculata as being endemic to the Red Sea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length6.3 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max20 m

Depth min1 m

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acentronura tentaculata has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P618 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Diversity (π)6.5%

Haplotypes2

BIN1

Most divergent pair12.9%

Where individuals differ — all 80 variable positions, in barcode order

18Cmostly conserved

21Amostly conserved

27Gmostly conserved

30Gmostly conserved

33Amostly conserved

39Cmostly conserved

48Amostly conserved

51Tmostly conserved

54Amostly conserved

60Gmostly conserved

81Cmostly conserved

87Cmostly conserved

108Amostly conserved

111Tmostly conserved

114Cmostly conserved

126Amostly conserved

144Cmostly conserved

159Tmostly conserved

162Tmostly conserved

165Tmostly conserved

168Gmostly conserved

171Amostly conserved

177Gmostly conserved

180Tmostly conserved

189Amostly conserved

192Tmostly conserved

198Gmostly conserved

207Tmostly conserved

222Amostly conserved

223Cmostly conserved

225Gmostly conserved

231Cmostly conserved

234Amostly conserved

237Gmostly conserved

240Tmostly conserved

243Cmostly conserved

246Tmostly conserved

261Cmostly conserved

264Amostly conserved

273Amostly conserved

279Amostly conserved

282Amostly conserved

285Amostly conserved

288Gmostly conserved

307Tmostly conserved

312Gmostly conserved

321Tmostly conserved

327Tmostly conserved

330Gmostly conserved

342Gmostly conserved

346Cmostly conserved

363Cmostly conserved

384Tmostly conserved

387Tmostly conserved

411Tmostly conserved

423Tmostly conserved

429Gmostly conserved

435Gmostly conserved

438Cmostly conserved

441Tmostly conserved

447Gmostly conserved

456Amostly conserved

459Cmostly conserved

460Tmostly conserved

462Gmostly conserved

495Cmostly conserved

501Cmostly conserved

502Tmostly conserved

513Tmostly conserved

525Gmostly conserved

528Tmostly conserved

531Cmostly conserved

543Cmostly conserved

552Tmostly conserved

567Tmostly conserved

570Tmostly conserved

579Cmostly conserved

591Tmostly conserved

600Cmostly conserved

609Gmostly conserved

GGCACTGCACTTAGTCTCTTAATCCGGGCGGAACTTAGCCAACCAGGAGCTTTACTTGGGGATGACCAGATTTATAATGTCATCGTCACA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arcos rhodospilussame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_065489 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBrrn12rrn16

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type42 records

Wild obs. + sensor22

Museum / vouchered20

Range

Area of Occupancy AOO92 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.5 m · max 1.5 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 6≤1 km 5≤10 km 5>10 km 1

17 georeferenced · 5 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	5
Frankfurt am Main	4
Cambridge, US	1
Kagoshima University Museumlocation not on record	1

4 institutions · 11 of 20 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Acentronura tentaculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)