Acentrogobius dayi

Koumans, 1941 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Gobiidae/Acentrogobius

At a glance

Occurrence records22

Data sources8

Biological traits7

DNA specimens5

eDNA detections25

Sources8 archives

Databases and archives Acentrogobius dayi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 records↗

OBISOcean Biodiversity Information System12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS22 records

Environmental DNA1 datasets · 1 countries25 detections

DNA & barcodingBOLD5 specimens

01Narrative

Acentrogobius dayi is een straalvinnige vissensoort uit de familie van grondels (Gobiidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1941 door Koumans.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length11 cm

Habitat & environment4

Habitat brackishyes

Habitat freshwateryes

Habitat saltwateryes

Habitat zonedemersal

Other traits2

Depth max18 m

Vulnerability10

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acentrogobius dayi has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections25

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P615 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

12Amostly conserved

183Tmostly conserved

195Cmostly conserved

333Amostly conserved

444Gmostly conserved

507Cmostly conserved

GGCACAGCATTAAGCTTGCTCATTCGGGCTGAATTAAGTCAACCGGGGGCTCTCCTGGGAGACGACCAAATCTATAACGTAATCGTCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.39%

Haplotypes5

BIN1

Most divergent pair0.49%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Exyrias puntangsame family13.2%Acentrogobius viridipunctatussame genus13.3%Acentrogobius janthinopterussame genus14.3%Exyrias belissimussame family15.6%Drombus triangularissame family16.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type22 records

Wild obs. + sensor4

Museum / vouchered17

Other1

Origin

Native3

Range

Area of Occupancy AOO48 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.7 m · max 2.7 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 2 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 1>10 km 1

3 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Los Angeles, US	3
Toronto, CA	2
Washington, US	1
Frankfurt am Main	1

4 institutions · 7 of 17 vouchered records shown

09Environmental DNA25 detections

Where the DNA of Acentrogobius dayi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median33.5 °C 33.5–35.2

Seasonal swing summer↔winter14.6 °C

Max temp (day)36.8 °C 36.8–40.5

Min temp (night)30.4 °C 30.2–30.4

Precipitation0.6 mm/mo 0.6–0.8

Air humidity58.1 % 53.1–58.1

Moisture balance-210 mm/mo -210–-185

Vapour deficit2,155 Pa 2,155–2,652

Wind speed4.00 m/s 2.90–4.00

Cloud cover2.00 % 1.90–2.00

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)