Acentrogobius caninus

(Valenciennes, 1837) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Gobiidae/Acentrogobius

At a glance

Occurrence records807

Data sources10

Biological traits7

DNA specimens32

eDNA detections27

Sources10 archives

Databases and archives Acentrogobius caninus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility354 records↗

OBISOcean Biodiversity Information System453 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS807 records

Environmental DNA1 datasets · 3 countries27 detections

DNA & barcodingBOLD32 specimens

01Narrative

Acentrogobius caninus, also known as the tropical sand goby or green-shouldered goby, is an amphidromous benthopelagic species of fish in the family Gobiidae. It is endemic throughout the Indo-West Pacific and found throughout marine, fresh, and brackish water. It is recognisable by its grey body with brown markings across its body, as well as the distinct dark green spot above its pectoral fins.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length18.3 cm

Body mass51.6 g

Habitat & environment4

Habitat brackishyes

Habitat freshwateryes

Habitat saltwateryes

Habitat zonedemersal

Other traits1

Vulnerability10

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acentrogobius caninus has left across the world's sequence archives.

At a glance

DNA specimens32

BINs5

Marker genes1

eDNA detections27

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 86 variable positions, in barcode order

4Tmostly conserved

10Gmostly conserved

13Amostly conserved

37Cmostly conserved

40Gmostly conserved

47Tmostly conserved

55Tmostly conserved

58Avariable

61Tmostly conserved

64Gmostly conserved

82Gmostly conserved

85Gmostly conserved

88Gmostly conserved

92Tmostly conserved

97Avariable

100Cmostly conserved

103Tmostly conserved

112Cvariable

118Amostly conserved

169Tmostly conserved

172Amostly conserved

175Cvariable

181Gmostly conserved

190Tmostly conserved

196Tmostly conserved

199Tmostly conserved

205Amostly conserved

211Tmostly conserved

214Gmostly conserved

220Tmostly conserved

226Gmostly conserved

229Tmostly conserved

232Tvariable

247Tmostly conserved

250Gmostly conserved

259Gmostly conserved

265Gmostly conserved

280Cmostly conserved

283Cvariable

287Cmostly conserved

298Amostly conserved

301Cvariable

307Amostly conserved

310Cmostly conserved

313Amostly conserved

316Gmostly conserved

334Gvariable

337Tmostly conserved

343Gmostly conserved

344Tmostly conserved

346Gmostly conserved

352Cmostly conserved

356Cmostly conserved

361Amostly conserved

370Amostly conserved

376Amostly conserved

391Tmostly conserved

406Amostly conserved

418Tmostly conserved

425Cmostly conserved

427Amostly conserved

430Gmostly conserved

433Amostly conserved

439Cmostly conserved

463Gmostly conserved

469Avariable

475Cmostly conserved

496Cmostly conserved

497Cmostly conserved

499Gmostly conserved

511Cmostly conserved

526Amostly conserved

529Tmostly conserved

530Tmostly conserved

532Amostly conserved

535Tvariable

544Amostly conserved

562Tmostly conserved

574Gmostly conserved

577Cmostly conserved

578Tmostly conserved

625Gmostly conserved

628Gmostly conserved

634Gmostly conserved

640Amostly conserved

652Cmostly conserved

CCTTTACCTGGTATTTGGTGCCTGAGCTGGAATAGTCGGGACAGCATTAAGCCTTCTAATTCGGGCCGAGCTTAGTCAACCGGGGGCGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes11

BINs5

Most divergent pair11.2%

AsiaOceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acentrogobius nebulosussame genus15.2%Monacanthus chinensissame order16.7%Bathygobius geminatussame family17.0%Ichthyococcus ovatussame order17.6%Amblyeleotris sungamisame family17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_041193 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type807 records

Wild obs. + sensor116

Museum / vouchered631

Cultivated / captive50

Other10

Origin

Native10

Range

Area of Occupancy AOO1 096 km²

Depth

0–200 m sunlit75

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 18.5 m · max 33.5 m · 75 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 14≤1 km 60≤10 km 1>10 km 14

89 georeferenced · 27 without coordinates

Open the mapobservation + sensor116

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 21≤1 km 116≤10 km 62>10 km 24

223 georeferenced · 408 without coordinates

Open the institutions mapphysical evidence631

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 50

50 georeferenced

Open the mapnot free-living50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum and Art Gallery of the Northern Territorylocation not on record	49
Sydney, AU	36
Kagoshima University Museumlocation not on record	26
Natick, US	17
CASlocation not on record	17
Washington, US	15
Australian National Fish Collectionlocation not on record	14
Paris, FR	13
Curtin Universitylocation not on record	10
Toronto, CA	9
Frankfurt am Main	6
Ann Arbor, US	6
Louisiana State University, Museum of Zoologylocation not on record	4
Texas Cooperative Wildlife Collectionlocation not on record	4
Fisheries Research Laboratory, Mie Universitylocation not on record	2
North Carolina Museum of Natural Scienceslocation not on record	2
DEWlocation not on record	2
Los Angeles, US	2
	2
Cambridge, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Vancouver, CA	1
FishBaselocation not on record	1
SEAOBISlocation not on record	1
Copenhagen, DK	1
Western Australian Museumlocation not on record	1

26 institutions · 245 of 631 vouchered records shown · 17 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA27 detections

Where the DNA of Acentrogobius caninus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map3 countries0

Canal

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.6 °C 24.7–28.8

Seasonal swing summer↔winter10.9 °C

Max temp (day)29.5 °C 26.9–31.0

Min temp (night)26.4 °C 22.3–27.1

Precipitation240 mm/mo 17.8–351

Air humidity65.1 % 61.4–66.8

Vapour deficit1,284 Pa 1,163–1,402

Cloud cover47.8 % 39.6–75.3

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)