Accipiter rufiventris

A.Smith, 1830 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Accipitriformes/Accipitridae/Accipiter

At a glance

Occurrence records6 724

Data sources11

Biological traits28

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Accipiter rufiventris's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 724 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Occurrence & distributionGBIF6 724 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD3 specimens

Genome at a glanceGoaT · NCBI≈1.2 Gbp

01Narrative

The rufous-breasted sparrowhawk (Accipiter rufiventris), also known as the rufous-chested sparrowhawk and as the red-breasted sparrowhawk, is a species of bird of prey in the family Accipitridae. It is found in Angola, Democratic Republic of the Congo, Eritrea, Eswatini, Ethiopia, Kenya, Lesotho, Malawi, Mozambique, Rwanda, South Africa, South Sudan, Tanzania, Uganda, Zambia, and Zimbabwe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAVONETAmnioteDBEltonTraits

Size & morphology12

Beak depth10 mm

Beak length (culmen)20.3 mm

Beak length (nares)10.7 mm

Beak width7.8 mm

Body mass198 g

Hand-wing index38.1

Kipp's distance83 mm

SVL32.5 cm

Secondary length134 mm

Tail length166 mm

Tarsus length54.2 mm

Wing length219 mm

Life cycle & reproduction3

Egg mass23 g

Fledging age29 days

Litter size3

Diet & foraging9

Aerial20 %

Ground20 %

Invertebrate10 %

Midhigh30 %

Trophic levelcarnivore

Trophic nicheVertivore

Understory30 %

Vertebrate ectotherm10 %

Vertebrate endotherm80 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleAerial

Range size756 057 km²

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Accipiter rufiventris has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

eDNA detections3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P298 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BINs0

CTTATACTTAATCTTTGGCGCTTGAGCCGGCATAGTTGGTACTGCCCTTAGCCTGCTCATTCGCGCAGAACTTGGCCAACCAGGCACACT …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Accipiter rufiventris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 218 545 930 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Accipiter rufiventris1.22 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type6 724 records

Wild obs. + sensor6 682

Museum / vouchered23

Other19

Range

Area of Occupancy AOO7 468 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 169≤1 km 45≤10 km 6>10 km 10

230 georeferenced · 6 452 without coordinates

Open the mapobservation + sensor6 682

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MRAClocation not on record	11
South Kensington, GB	9
Provincia di Livornolocation not on record	2
CPMMlocation not on record	1

4 institutions · 23 of 23 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Accipiter rufiventris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Accipiter rufiventris

At a glance

Sources11 archives

Size & morphology12

Life cycle & reproduction3

Diet & foraging9

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type6 724 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type6 724 records